Busch Lab

ZMP

si:dkey-179o14.1

Ensembl ID:
ENSDARG00000078902
ZFIN ID:
ZDB-GENE-090313-203
Description:
Novel protein similar to H.sapiens RIMS1, regulating synaptic membrane exocytosis 1 (RIMS1) [Source:
Human Orthologues:
RIMS1, RIMS2, RIMS3, RIMS4
Human Descriptions:
regulating synaptic membrane exocytosis 1 [Source:HGNC Symbol;Acc:17282]
regulating synaptic membrane exocytosis 2 [Source:HGNC Symbol;Acc:17283]
regulating synaptic membrane exocytosis 3 [Source:HGNC Symbol;Acc:21292]
regulating synaptic membrane exocytosis 4 [Source:HGNC Symbol;Acc:16183]
Mouse Orthologues:
Rims1, Rims2, Rims3, Rims4
Mouse Descriptions:
regulating synaptic membrane exocytosis 1 Gene [Source:MGI Symbol;Acc:MGI:2152971]
regulating synaptic membrane exocytosis 2 Gene [Source:MGI Symbol;Acc:MGI:2152972]
regulating synaptic membrane exocytosis 3 Gene [Source:MGI Symbol;Acc:MGI:2443331]
regulating synaptic membrane exocytosis 4 Gene [Source:MGI Symbol;Acc:MGI:2674366]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa17171 Essential Splice Site Available for shipment Available now
sa24851 Nonsense Mutation detected in F1 DNA Not yet available
sa32698 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa17171
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087115 Essential Splice Site 56 1172 None 23
ENSDART00000138847 Essential Splice Site 56 127 None 2
ENSDART00000147566 None None 319 None 8
Genomic Location (Zv9):
Chromosome 1 (position 30926103)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 30739563
GRCz11 1 31472131
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCCTCAARCCAACAGCTGMATATGTTTTCTCTTTGTCCATTRTTTCCACC[A/T]GGACACTGCACCAGCAGTTTGAGAGTTATAAGGAGCAGGTGAGGAAGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24851
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087115 Nonsense 296 1172 5 23
ENSDART00000138847 None None 127 None 2
ENSDART00000147566 None None 319 None 8
Genomic Location (Zv9):
Chromosome 1 (position 30900068)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 30713528
GRCz11 1 31446096
KASP Assay ID:
554-7634.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCACCCACCCTGAGCGACGAAGAAGACAGGAGGAGGAAGAGCGAGAGCGG[C/T]AAAGACGAGAGGAAGAGTACCAGACCCGTTACCGTAGTGACCCCAATCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32698
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087115 Essential Splice Site 1019 1172 20 23
ENSDART00000138847 None None 127 None 2
ENSDART00000147566 None None 319 None 8
Genomic Location (Zv9):
Chromosome 1 (position 30857652)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 30671112
GRCz11 1 31403680
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTGTCTCTTTTCATGTCATTCCTCATTCCTACAACCCCATCTTCACGAA[G/T]GCCGTATACCTGAGGAGAAACCTAACTCAGGTATCTCATACCATCCTCAG
Associated Phenotype:
Not determined