Busch Lab

ZMP

ANKS1A (2 of 2)

Ensembl ID:
ENSDARG00000078901
Description:
ankyrin repeat and sterile alpha motif domain containing 1A [Source:HGNC Symbol;Acc:20961]
Human Orthologue:
ANKS1A
Human Description:
ankyrin repeat and sterile alpha motif domain containing 1A [Source:HGNC Symbol;Acc:20961]
Mouse Orthologue:
Anks1
Mouse Description:
ankyrin repeat and SAM domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2446180]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa45267 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3587
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110433 Nonsense 58 483 2 12
ENSDART00000110433 Nonsense 58 483 2 12
Genomic Location (Zv9):
Chromosome 6 (position 54352580)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 54389314
GRCz11 6 54397422
KASP Assay ID:
2259-8212.1 (used for ordering genotyping assays)
KASP Sequence:
TGATGGAAGACGAGGACCTTCAYGAAATTGGCATCACCGATCCAGGCCAC[A/T]GAAAGAAAATCCTTCATGCAGCAAAAAGCCTTCCAAAGGTACCAWGTTTC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa18856
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110433 Nonsense 58 483 2 12
ENSDART00000110433 Nonsense 58 483 2 12
Genomic Location (Zv9):
Chromosome 6 (position 54352580)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 54389314
GRCz11 6 54397422
KASP Assay ID:
2259-8212.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGATGGAAGACGAGGACCTTCACGAAATTGGCATCACCGATCCAGGCCAC[A/T]GAAAGAAAATCCTTCATGCAGCAAAAAGCCTTCCAAAGGTACCATGTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45267
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110433 Essential Splice Site 120 483 4 12
Genomic Location (Zv9):
Chromosome 6 (position 54353156)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 54389890
GRCz11 6 54397998
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCAGGGAGTAGATGCATAACGTGTACACTGACCATCATTTCTATGTGCA[G/T]GTGTTAAAAATTGGCCTTCTTGGTCACAGAAAAAGGATCATAGCCTCGAT
Associated Phenotype:
Not determined