Busch Lab

ZMP

prp

Ensembl ID:
ENSDARG00000078899
ZFIN ID:
ZDB-GENE-090826-1
Human Orthologue:
COL22A1
Human Description:
collagen, type XXII, alpha 1 [Source:HGNC Symbol;Acc:22989]
Mouse Orthologue:
Col22a1
Mouse Description:
collagen, type XXII, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:1916950]

Alleles

There are 9 alleles of this gene:

Allele Name Consequence Status Availability
sa30459 Nonsense Mutation detected in F1 DNA Not yet available
sa30458 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa19381 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa30457 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa38193 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa45027 Nonsense Mutation detected in F1 DNA Not yet available
sa24791 Nonsense Available for shipment Available now
sa44408 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa30459
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111540 Nonsense 497 1634 9 68
Genomic Location (Zv9):
Chromosome Zv9_NA466 (position 94368)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150214.1 94368
GRCz11 KN150214.1 94368
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCATCCTACAGGGTGATACAGGTCTACCGGGTGCCCCGGGGCCCAAGGGT[G/T]AAAAGGTCAATTAGCATTTTACAATCACAACATCCTCAATATGCATCTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30458
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111540 Essential Splice Site 586 1634 14 68
Genomic Location (Zv9):
Chromosome Zv9_NA466 (position 82139)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150214.1 82139
GRCz11 KN150214.1 82139
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATCAAGGAGTTGCTGGTGAAGCTGGGCTGCCTGGACCACTCGGACCAAAG[G/A]TTAGACATTAACACTTACAGACAGAGTTACAGTGTTTCTTGATGAGCCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19381
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111540 Essential Splice Site 641 1634 17 68
Genomic Location (Zv9):
Chromosome Zv9_NA466 (position 76978)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150214.1 76978
GRCz11 KN150214.1 76978
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTAGAGGGCTGATTGGTGCTCCTGGTCCAAATGGAGTAAAAGGAGAAAAG[G/T]TAGAGTTGTGCAATTTATTATCTAATTTTATTATTTTATTTCATATTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30457
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111540 Essential Splice Site 682 1634 21 68
Genomic Location (Zv9):
Chromosome Zv9_NA466 (position 72887)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150214.1 72887
GRCz11 KN150214.1 72887
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCATTGTTTTTAATCAGCCTATTGTTGATGCTGTTTTTTTTTTCTTCCAC[A/T]GGGTCCTCCTGGACCTCCAGGTTTGCCTGGTGAGACGGGTGACACTGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38193
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111540 Essential Splice Site 887 1634 33 68
Genomic Location (Zv9):
Chromosome Zv9_NA466 (position 52505)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150214.1 52505
GRCz11 KN150214.1 52505
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTAACTGTTAACATTAATATAATAATATCACAATATCTTTGATATTTCC[A/T]GGGTCAAAGAGGACTACCTGGAGAGCAAGGTTTCAGAGGACAACCAGGAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30456
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111540 Essential Splice Site 1113 1634 47 68
Genomic Location (Zv9):
Chromosome Zv9_NA466 (position 42860)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150214.1 42860
GRCz11 KN150214.1 42860
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTTGTTTTCCAGGGAAAAGCTGCAGACCTTTCTGATCTAAACCTGAAGG[T/C]ATCAGCACGCGTCCATCAAGCCCTGCAAATATCATTAATTTATTCATCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45027
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111540 Nonsense 1374 1634 61 68
Genomic Location (Zv9):
Chromosome Zv9_NA466 (position 34096)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150214.1 34096
GRCz11 KN150214.1 34096
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGAAGCAGGGAGCCCAGGATTACCAGGCTTCCCAGGTCCAAAAGGGCCAT[C/A]GGTGAGTTGAGACGTTGGATCGGTTCTGATAGATTTTTTTTTTTGTTCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24791
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111540 Nonsense 1393 1634 63 68
Genomic Location (Zv9):
Chromosome Zv9_NA466 (position 33755)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150214.1 33755
GRCz11 KN150214.1 33755
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATTATTTGAACTAAACTTGTGTTTATCACAGGGCATGTTAGGAAAAGCT[G/T]GAGACCGAGGACAGAAGGGAGAAAAGGTTTGCATGCATAGGTCCACCTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44408
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111540 Essential Splice Site 1401 1634 63 68
Genomic Location (Zv9):
Chromosome Zv9_NA466 (position 33728)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150214.1 33728
GRCz11 KN150214.1 33728
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACAGGGCATGTTAGGAAAAGCTGGAGACCGAGGACAGAAGGGAGAAAAG[G/A]TTTGCATGCATAGGTCCACCTAATCATCTATCAGTCCATAATTTAACCAT
Associated Phenotype:
Not determined