Busch Lab

ZMP

si:ch211-259k10.1

Ensembl ID:
ENSDARG00000078890
ZFIN ID:
ZDB-GENE-070705-153
Description:
Novel protein similar to vertebrate WD repeat and FYVE domain containing 3 (WDFY3) [Source:UniProtKB
Mouse Orthologue:
Wdfy3
Mouse Description:
WD repeat and FYVE domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:1096875]

Alleles

There are 14 alleles of this gene:

Allele Name Consequence Status Availability
sa33670 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa17802 Essential Splice Site, Missense Available for shipment Available now
sa20498 Nonsense Available for shipment Available now
sa9941 Essential Splice Site Available for shipment Available now
sa33669 Nonsense Available for shipment Available now
sa2247 Nonsense F2 line generated Not yet available
sa20497 Nonsense Available for shipment Available now
sa10584 Nonsense Available for shipment Available now
sa2246 Essential Splice Site F2 line generated Not yet available
sa14824 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa6996 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa33670
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114481 Essential Splice Site 339 3522 7 65
ENSDART00000146664 Essential Splice Site 319 375 6 7
Genomic Location (Zv9):
Chromosome 5 (position 41781605)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 39556322
GRCz11 5 40156475
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GACTTCCGCATGTGTCAGGGCTACACCTTCCTCATAGATCTTATGATCAG[G/T]TGACTTATTTGTAATTGTTTATTGCATGTTTAAATGTTTAGTGTTTTATA
Long Flanking Sequence:
ATTTACTCAACGTCCAGTTGCTCCAAACTATATGAGTTTCTTTGTTCTGTTCAACACAAAGGAAGATATTCTAAATAAAAAACAGTGATTGACTTCTGAAGATCAATGGCTGTTTTTTCCCCAACGTTTTTCAGAATATCTTATTTTGTTTTTAACAGAACAAAGAATTTAAAAATATTTAGATAAACGGTAAATGAGGAAATTTTCATTTTTGGGTGAACAAACCCTTAAAGTGACCCTTGTAGATTTTACCTAAAATTTTATATTATGACTAAAATTCATAACCGACATGAAACAATTTTTGTTTTGGCAGAGAAAGAGTGCTTATCAACATGCATCCAGAACATGCAGCAGTCAGATGACCTTTCTCCTCTGGAGATTGTGGAGATGTTCGCTGGGCTCTCCTGTTTCCTGAAGGACTCGAGTGATGTCTCTCAGACACTGCTGGATGACTTCCGCATGTGTCAGGGCTACACCTTCCTCATAGATCTTATGATCAG[G/T]TGACTTATTTGTAATTGTTTATTGCATGTTTAAATGTTTAGTGTTTTATATTGTTTTGAGCTCTGGTTATCAGCGCGGCATTGTTCTGTTTTTATTTTAAAACATGGCTTTAACAAAACATGGCTTAACGGATAAAACTTTTATTTTGGAATTCATTGAGCACAACCATTCAAAAACTTGGGTTGGAAAGATGAAAAAATTACATCTTTTAATTTGATTAAAATACAGTAATCTTATTAAAGTTTATAATAATTGTAAGAATCAAGTGTCACATTATCCTTCAGAAATCATTCTATTAAGCTGATTCGGCAACATCTGCTAATGATTGTGTTTTGAAATCACTTGTGCTGAATAATCATTTTGTAAAAATCTAGACATTTATGGATTAATTGATAAATATCAACTTGTTTTTTATGTAATAGCTTCTAGCAAGATAATAAAGCAATCTCTTTCAATTACATTTCTTCTTTCTATTGTTTGGGATCAGTTAAAAAAATAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17802
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site, Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114481 Essential Splice Site 394 3522 8 65
ENSDART00000146664 Missense 375 375 7 7
Genomic Location (Zv9):
Chromosome 5 (position 41780305)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 39555022
GRCz11 5 40155175
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGCACCCTTCCTGCTTCCAGGTTTTGTGGTTCCACAGCCTTCTGGGAAAG[G/A]TCAGCCCTCTATAAAATAGCATACACTGGAGTCTTGACTTGTGTCATTGC
Long Flanking Sequence:
CAAACCAGTTTAAGTTTTTTTTTCTTCTCTTGAACACATAAGATATATTAAATAATATTGGAAACCTGTTATTATAGACTTATATATTTCCTTAATGCTTCCAACATTCTTCAAAATAACTTCTTTTTTGTTCAACACAATAGCAAAGCTCAAACAGGTTTGGAACAAGTCAAGGATGAGTAAATGATTTTTGGGTGAACTATCCTTTTACATTATGTAAAAAGATCACTTACCCCTAAATATTTGTCTTTTAAATGTGCTAATAAAAGTTTTTTTGCAATCCTGATACGATCGATTAGTGATATTCTCTGTTGTACTTGCTCTACTTCTTAGGTTGGAGCAGGCCAAAGAGGATGAATCCAAAGATGCTCTAAAGGACCTGGTGAACCTGGTGACCGCTCTGACCACATATGGTGTCAGTGAGCTGAAGCCAGCTGGACTTACCACCGGAGCACCCTTCCTGCTTCCAGGTTTTGTGGTTCCACAGCCTTCTGGGAAAG[G/A]TCAGCCCTCTATAAAATAGCATACACTGGAGTCTTGACTTGTGTCATTGCACAGCTGGGTGTGAAAGCTGGTGATGTGAAATTCCGGGTGTGTTGAACTTCAGCCAGGAAACACTAAGAAATCGAGGCATTCACAGGATTCAGATGGCAAGTTTGCAGTGTTAGGGCTTAAGTAGGGATTTAGTGTGCTTTTATGTTTGCGATTATTCTTTTTTTTTTTTTTTTCAATTGTTTTGCTTTTAGGACTTTTCGTAGTCAACATAAAATTTAAATAATGATTTAATCTCTTCTGGACAATTGGAAATTTTTGTACTGAAAATTTAGACTGATGTTCACCTCAGATGCGGATAAAGTGTCAAGTGTGAGTGATTTACATGTTAAGTCAATGTATAGATGTGATCAGACATCATGCGGCACTATTTGCGCAAATTAGGCGGCGCGAATGATGAGATGACATGGTGCGAATTGAGCATTTGACGTGCTTAATGCATGATTCCCGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20498
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114481 Nonsense 585 3522 11 65
ENSDART00000146664 None None 375 None 7
Genomic Location (Zv9):
Chromosome 5 (position 41770387)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 39545104
GRCz11 5 40145257
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTTGACATGGAGATGAGTTAATAATACAGATATGTCAATCTCTCAGGGT[T/A]GTTCCGGGAGTTTGGGGGAGCGCGGTGTGTGCACAACATTGTGAAGTATC
Long Flanking Sequence:
ACATTGCTTTGTTTTAAAACAGTACAGCACACCCCTAAGGCTTTCATTATAATTACATTATCGTTGTCCAAGTTTGCCTTTTGTTTCCAAGCACTCAGGGACGAGGAAGAATTCATTTCCATGCTCTCAGACCCCGCAGTTGTCTCAGTCTCAGTGCTGAGTCAGGTCTCTGCTAGAGAAACTCTCTGGACTTCAGCTCTCTAATCATTTCTCCTTTCTGTCATGACTGCTGATAGTCTCACAGATGCGCTCGTACTTCATTAATTGTCAGCCAATCAGAATGGCTTTGCTGCAGAAATTGAGTCATTTAAAATGCTTTGCTTCCTTTGAGGTGATCAGTCATTCCTAAATCTCATTATTACCAGCTCTTGATTGTTCTAATGTTTACATAAACAGAACATTAAACTTGTTGCCGAGCTGTAATGTTGAACATTAAACTGAACATTGCTTATTTGACATGGAGATGAGTTAATAATACAGATATGTCAATCTCTCAGGGT[T/A]GTTCCGGGAGTTTGGGGGAGCGCGGTGTGTGCACAACATTGTGAAGTATCGTCAGTGTCGTGAGCACGCTCTGATGATCATCCAGCAGCTGGTCTTGTCGCCGTCTGGAGATGATGACATGGGCACTCTGCTCGGCCTCATGCACTCCGCTCCAACAGCAGAACTACAGCTCAAAACTGACATCCTGCGGGTGAGGCACATTAACAAATCTGCCATGCTTTATTTAAATAGATGGGAAATAGAAGCAGAATTCACTACATTTTTTTCCATATTTGCATGAATACATTGGCCTTCTAAAATTTGAGGTTTGGAAGTGTTTACTTTTGTTTTATTTTATTTTTTATCATTTCAAAGTTTTATCATTACAAATGTTTGTATTATCGGTTTAATGCATCCTTGCTGAATAAAATAATTTGATTCTATATATAGCTATATATAACTGACAGTTATATAAAAAATTTAACCTATAAATTCATAAAATAAAAATTTGTGTTAATTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9941
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114481 Essential Splice Site 829 3522 13 65
ENSDART00000146664 None None 375 None 7
Genomic Location (Zv9):
Chromosome 5 (position 41767565)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 39542282
GRCz11 5 40142435
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAGACCTCGCTGCCCTCCCCTTGGGGCACGCCAGCAATCACCAGGAAGAG[G/A]TACTGCTTTCTGCCACCTCTTCCTTTTTCTCCCTCTGTCTTTTCCTTCTT
Long Flanking Sequence:
CAAACAATTGTTTGCATGACTAAATAGACCAAGTAGAATAATATAATAAGAAAATATTAGTTTGCAATTTAAGTCTCAAAGGAAACCCATTTTATCTTATTCAAATAGTGTTTTGTAACTTTACTAGTTGAGTAGTGTGCAAAACAATTACTCAACTATTTTCTATCTGACAAGATGCAAATGTCCTCACATGCTATCTGAATGTGTCTGTGCTTTAAGCTTGTGTTCGTGGTAGATTTGCATGATCTGTAGTTCCTCTAAGCTGTATATTCAACAAGAACTAACTGCCTCCCTCTGTTGCTCTTTGTCATTTCTCTGTCTCTGGTAACCTCTGGCATTGCCTGGCTGCACACGCGGGGTATGTGTGTGTGTGTGTGTGTGTGTGTTTGTTTGGATGTGTGTTTAAATGGTTGTAGTCGTGCCGAGCAGGTGCCCCCCTGCTTGACTCACGAGACCTCGCTGCCCTCCCCTTGGGGCACGCCAGCAATCACCAGGAAGAG[G/A]TACTGCTTTCTGCCACCTCTTCCTTTTTCTCCCTCTGTCTTTTCCTTCTTATTTTCTTTTTCTGTTCTCTGCTTGTTGAGTGATCAGACTTTTGTCCTCCCAGTCTGTTTCCTTTTCCTTCTTTTATTCTCCTTTTTTTCTACTAACAACTTAAATGCTTAGGTTGTGTTATAGTGTTTTTCTCTTCACTTTTTTAAATATATAACTTTACAACTCCCCTAGATGTAAACATTTGTTTTATCATTTTTTAATCCATTCAGATTTAGGCTGAACAACAATATACTGTTTGAGCATCGATATCGCAGTGTGTGTGTCTGCAATAGTCACATTTCAGGATTAGATAATTTATTAAATATTATTAATTTTTTTTTTATTATGTATGCAATGACAGTGTTGCGCTAGTTACTGAAAATAGTAACTAGTTATAGTTACTAGTTACTTCGTTCAAAAAGTAACTCAATTACTTTATCGATTACTTACAGTAAAAAGTAATGTGTTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33669
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114481 Nonsense 1397 3522 23 65
ENSDART00000146664 None None 375 None 7
Genomic Location (Zv9):
Chromosome 5 (position 41733778)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 39508495
GRCz11 5 40108648
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCCACACCAGTCAAGCTTGTTCATAATGCAGTAGGCCATCTCAACGGAT[C/A]AGCCAGGACCGTTGGAGCTGCAGTCATTGGTTACCTGGGTGAGTGCATTT
Long Flanking Sequence:
AAATTAGGTGTTTATTTAATAACCATGACAGGCCTAAATATTAATGATGAAACAATGATTTAAATAATACAAAATGTTTCAGTGGATTTTTGCATTCATTTTTTAAAATGTTTTCCTAATCTAAATAACTAATGGATAAGACTTCCTAATTAAAATTAAACTCACCAACCACCGAATGGCAATGCCCTAAAATCTCAATACTTTTCTAAAGTTTGGATTCAGTGAGATATTTGTAATGATTTTAAAAAAGATCTCCTGCTCCTACAGTATAAATATTTGTATGTTTTTAGGAATACTGCAATGGATTTTTAACATTTTGGAAAAAAATAACCCCCAACAACTTTTGCAACAATTGTTCGAAAGGATCAGACTTTTTTTGGTCATATATTTAAAGGCTGCTCAGAGTGATGTTTTCATCCCGTTTCAGCTGGGGGTTTCCTCTCATGAAAGTGCCACACCAGTCAAGCTTGTTCATAATGCAGTAGGCCATCTCAACGGAT[C/A]AGCCAGGACCGTTGGAGCTGCAGTCATTGGTTACCTGGGTGAGTGCATTTTCATTAGGAGCGTGGACATGGGTGAAGTTTGTTTTTGGACAATAAAGCATTAAATACATGGATGATGAAAATAAGAGAAGCTGCTCCAGCTCTTTCTCTCCACCTATTTATAACTGCAATCTTTTTCCATGTAGGTGTGCGGGCCTTTGTAACCAAACCAGTGGCCACCAACCTCCAGTACATCGGAGGAGCAGCTGCCATTCTGGGCCTGGTTGCCATGGCATCAGACGTGGAGGGTCTATATGCCGCAGTAAAAGCATTAGTGTGTGTTGTCAAGAGCAACCCACTTGCGAGCAAGGAGATGGAGCGTATCAAAGGCTACCAGGTGGGCTGCATAGACAATTACCCGGTGAACTTTGAACCCAGGATGTCCTCTGTTCTCCGCAGCTGTAGCTGTAGGATGTTATGAGCCAATGAGGTGGCAAATGAAATGATAACATTGATGCTGGG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5313
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114481 Nonsense 2116 3522 37 65
ENSDART00000146664 None None 375 None 7
Genomic Location (Zv9):
Chromosome 5 (position 41715593)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 39490310
GRCz11 5 40090463
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACCGAACAATACTCTACCAGCTCTCACGACCACACAAGACCGTCCCGCAG[C/T]AGGTCACCCTGCTGGATTCACTACGTGTGCTGACGGTAAACCGAAATCTC
Long Flanking Sequence:
AAAGAGGATGATAATAAGCATTAGTAGCAGCTGTACTTATCTGTTTTAAGATGAGAAATTAATTATTAAACAAATATGGCAATGAAAATTCCAAACACTTTATTTACCCACCATGCATTTAAGAAAGACTCACAGTGTAATATGTCAAAGGCACATATAGATACTTATCATAAAATTATGATAAAATGATATTTATCATATCATATTATCCTTATCAATAATTATCCTGCTATTTCTTTCCAACTTTCTGTTACTAGTTCAGCACTTTTACTCTCTCTCTTTCTTTCTTTTACGTTTGTCATGTGCAAGACTTACGTTGCATTCCAACATGACTTATGTGTTTGGTGGTCTCTGAACAAATCTCCTTTTCTACTTTTTTTTTTTTTCTCTCTCAACAGTCCAAACGGCGATCACAGGGTTTGTCTCTCGACTCAGTCTATCATTGTCTAAACCGAACAATACTCTACCAGCTCTCACGACCACACAAGACCGTCCCGCAG[C/T]AGGTCACCCTGCTGGATTCACTACGTGTGCTGACGGTAAACCGAAATCTCGTGTTGGGTCCCGGGAACCATGACCAGGAGTTTGTGGCCTGCCTGGCCCACTGTTTGATCAACCTGCACACGGGAAGGTGAGAGAGAAAAACATAGAGACTGTATCATATTTTGAGCTTTATGATTTTGTAGTTTATGCTTTATTTAACAAGAAGTAAAATTGAAGGTTAAAAAGGTTGATCTGATATGAAAGGTAGATAGTGTGTCTTCCTTTAGACAGACAAGGAAACTCTGATTCTCTATATTTGTTTTTTCCTGAAAAATTAATTTATGTTATTACTAAATGATTAAATGTTATCTAGCAACATGCATTATTATTAATATAATACAGGTTTTAATAATATGTGTGTTATTGTTAATAACACATCGCTATTATCACTATTAATTTCAACAATAAAGCAGTATCAGTTTGCATCAAAATACATTCAGAATCCATTTATTTTTCTTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2247
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114481 Nonsense 2452 3522 43 65
ENSDART00000146664 None None 375 None 7
Genomic Location (Zv9):
Chromosome 5 (position 41706026)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 39480743
GRCz11 5 40080896
KASP Assay ID:
554-3279.1 (used for ordering genotyping assays)
KASP Sequence:
CGGGAATGTACCAGCACTCCATAGAGCAGAACACAGAGGGAGAAACCACA[C/T]AACAAGAACCCGAACATGGAGAGGACACCATCGCAAGGGTCAAAGGTCAG
Long Flanking Sequence:
AAACCAGATTTCTTATTAAATGTATTTAATTTTTAAGAGTAAATGTATATATTTATGTCTTGTGTTTCCTTCAAATGATTCATTACAAATTATTGTACCAAATGTTTGAACACTTTTTGTTTGTGTTGTCTTAAAAAATTAATCTAAAAATGTGTAGAAATGCCTAAAAGTGCTTTATAGGTCAATTTAAACGTAACATTCATTTGAGCTGTCAGTGTGGGCTTTTCTTAAGGAGTGATGTACATGTGGTTTGCATGGCTCTGGATTCTTCTTTCACTGTCATTCAAGATGATATTTTGCATTATAAAATGAAAGATGAGCTAATCAGAACTAAATACATCATATAAACAGTTTTTATTATATTTCAATTGTTTCAGAAGCCAGCCCGATACCGGCGAGCAATCAGCTATGACAGTAAGGAGTATTACATGAGGCTATTGTCTGGAAACCCGGGAATGTACCAGCACTCCATAGAGCAGAACACAGAGGGAGAAACCACA[C/T]AACAAGAACCCGAACATGGAGAGGACACCATCGCAAGGGTCAAAGGTCAGCAATCTTTATTTGATATTCTGAAATGATTACAGAAATTTCCATGGTTACGTTTTCATTTACAGTCCTGTTTCACATGCACATGCTGTGTACTTATTATAGTAATTACAATAACTGGATAATAACTAGGTGCTAACTCTGAACCTAAATTTATCCCACATACGTATCTGTTAGCTATTACTTTCATAAAGAGAGTGGCTGCACTTTATTTTACAGTACAGTACATGAGTTACACAGTACATTTTTCTCACAGATGTATGATAAATGATTGGTTGATTAATCCAATGTGATTTTTTGTGTGTTTTGTCAATAGAGATGTCTATTACGGATCTAGTAAATATCCAGCCTGTTCTTTCAGATGGAGCAGCATTTAATACAAAGAGTTGTAATTCACAGCTATCAATAGCTATATAAAAAAAATGGTTTCAACATCGAAATGGATTTAATCAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20497
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114481 Nonsense 2504 3522 44 65
ENSDART00000146664 None None 375 None 7
Genomic Location (Zv9):
Chromosome 5 (position 41703741)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 39478458
GRCz11 5 40078611
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCAAGACCAGCTGCAGGAGCTGCTGGAGTCAGGAGCAATGGATGAAGAG[C/T]AGAAAACAGACAACACCACACTGCTCCGTCTGCTGGAGGAGGGAGAGAAG
Long Flanking Sequence:
AGTAAACGAACACCACTAACAGTACAGTGAGTTTGGTAGAACTTTATTCTACAGTCCTGATTTTATGTGTTACATGAACTGGGATAATACATATTATTCTCAAACCTACTAGACCTAAGGTTACTCTGAACGTTAACCCACCTAGTTATCCTATGTAGTCTAAGCTTCCAAGGAGAAAAGTCAGACTTTACTGATTTTAACTAGACTATGAGTTTATAACTCAAAATTGTAAGATATACTGTAAACTCAGTTCCTTAATTCCATAGAACCTGTATAAATTGAATGAGATAACTGGTGTGCTGAATTACTGTTTTATTTAAACTACTGAGCATGTAATGATAGGAGTGCGTTGTGTGGACTGAATGAATGTGCTGTGTGTATGTGTTTTAGGTCTGGTAAAGGCCCCTTTGAAACGATCACGCTCTACAGCAGATGGGGCTGATGAGGAGAGTCAAGACCAGCTGCAGGAGCTGCTGGAGTCAGGAGCAATGGATGAAGAG[C/T]AGAAAACAGACAACACCACACTGCTCCGTCTGCTGGAGGAGGGAGAGAAGGTCTGCAGCATTACATAATAGAAATGAAACAAAACAGTTTGCTCATGGTTCAGTTCTTATCATGGATTTAGGGTCACGGATTTGGTACAGCTTGGTATGTGATATGTTCAGTAAAAAACGTAAAGCAATTTAGCAAAGAGATCACTAAAATAAACAGGCTTTTCAGGTATCTGATGGTAGATTTTAGGTACAAAAACTAAATGATATAATCAAATATAAAACTGCATACTATATATAAACGTCACTGTATTAAATAAAGGTTAAACATTATTTAAGTTACCTACAACAACTATTCAGTCACGAGCGTAGAGAGTGAATCCATTGTCATTTGTTGGTTGATTAATGTTAAAAACAGAGAGCAGAAATAAAATGTTTTCACTTTGACACACTCCACAGAGCTAGCACATTGAACAAGTTACAGATAACACAGTTTCTCAAATATTTAGGTTA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26537
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114481 Nonsense 2681 3522 49 65
ENSDART00000146664 None None 375 None 7
Genomic Location (Zv9):
Chromosome 5 (position 41698650)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 39473367
GRCz11 5 40073520
KASP Assay ID:
2259-6289.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTAATAGGTCAGGTCTTCTCAGTACGCTGGTCGGTGAGAAGTCAGTAACC[C/T]AAAGATGGGAGGTACGGTATCTCCACTTTCAATTTTTGCTCTGTTTTGAT
Long Flanking Sequence:
AGTTTCATTTGAAGTATAATTTTTTTAATTGTTATTACAAATTGATTAACTGATCAATTTAGCAGATCCTTACTACAAAACAAAAATATTATTATTATTATTATTATTATTATTATTATTATATTCTTTCCAGACCTCTGTGTGAGTACACAGTGACCACAGACGTCAGTTAGCATTCTTGACCTTGTGTTTTCTGAAGTGTACAACTACAAATCATTCAGCCGAACACTAGAATTAGCATAAGTGTTTAAAGTAAACAAATGTGGTATTTTTCAGGTTCCTGGCAGTGGTTCCCTCACTAGCCGACAGTTCAGAATCTGTCTCTGGGCAGCGTCCCAACACCAGTGTGGAACAGGGGTAAGTTTCCCCTTACATTACAAGATTATAATGTGATTTTGAGTTTATTTATTTAACTGAACAAAAAATAAATCTTCATATGTGTGTTTTTGGTTAATAGGTCAGGTCTTCTCAGTACGCTGGTCGGTGAGAAGTCAGTAACC[C/T]AAAGATGGGAGGTACGGTATCTCCACTTTCAATTTTTGCTCTGTTTTGATTTTGCACTTTTGCTTATGAAAGACTCTTTATTTGCAGAGAGGAGAAATCAGCAATTTCCAATATCTAATGCATCTCAACACACTGGCTGGCAGGTCTTACAATGACCTGATGCAATATCCAGTGTTTCCATGGATCCTGGCAGACTTTGACTCAGAGGTACAAATCTGACCTTCAGCATTTCTCTTAATAGATAATACAGCAGGAAACGTAGGCAAGCACGGTCAAATCTTTCAACGGTCAAGTCTTTTAGTACATCGAGTTGTTAGATTTTGCTTTGACTTTGATTGGTGGAATGTGTGCAATAATCAATAACGTTTAACGCCTTGTGACTAATCAAAGGGTGCTAATGTGAGTTTGCAAACTAATGCACAAAATGACATAACTTTTTTTTGTTGTTGTTGTTCTTTATTTTTTTGACTTGACACACTACACTAAAAACTGTCCGACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10584
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114481 Nonsense 2769 3522 52 65
ENSDART00000146664 None None 375 None 7
Genomic Location (Zv9):
Chromosome 5 (position 41697530)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 39472247
GRCz11 5 40072400
KASP Assay ID:
2259-6288.1 (used for ordering genotyping assays)
KASP Sequence:
CAAACTTTTAAAACAAGGTTTTRTTTCTGTACAGGCGAGACTCCGGCATA[T/G]CATTACGGCACTCATTACTCTTCTGCAATGATTGTTGCCTCATATCTGGT
Long Flanking Sequence:
AATTCACCTTCAACTCCAGTAGATCCTACTTTTGAATTTGAATTTATCATTATCACGTGACCTACATTAGTCAGTTGTGTCGCTTCACTCGCATTCATTTGTTTTTCATCAAGCGCCATCTAATGTCAGCGTGTGATTTTGCACACAAACTCATCACCAGTGAAAATGGCTTGGGCATGAATGGTAAAAAATGTTGGTGATTAAGAACTAGTGTTAAACATTTGAGGATGCATAAGACTTGAGCTTGAATCTTCTCTCAGCAAGTGAAATATTGTTGAATTACTCCTCAGGAACTGGACCTCAACAATCCAAAGACATTCCGAAATCTGTCCAAACCAATGGGAGCTCAAACAGATGACAGACTGATCCAGTACAAGAAAAGATTCAAAGATTGGGAGGATCCTAATGGTGAGTCGAAGTTGATGATATGCAGGTTCTTTGTGTTATGGGCAAACTTTTAAAACAAGGTTTTGTTTCTGTACAGGCGAGACTCCGGCATA[T/G]CATTACGGCACTCATTACTCTTCTGCAATGATTGTTGCCTCATATCTGGTCAGAATGGAGCCATTCACACAGATCTTCCTTAGGCTTCAGGTTAGTCCATGGCCTGTTTTTAGTTTTGTTTTTTAACTTTCTTCTTTTCCTTGTTTTTTTATTTTATTCTTGAGAGAGTTGTGAAGAAAAAAAATCTCTAAATAGAGTGTATATTCATATATATATTTAAACCATTTTTTTCATGTCTCTACATTGAAAGACAATCCTAAACATAACAGGATTTGTTGCTCGTCTTCGGTTGCTAAACTTTACCCATTCTTATTCAAATGTAAATACTTTATAATAAATTATGTAAAATTAGACATCTATAGCTTCAAAAACACAGTTAGATATAAAGCCTGGAGATGAGCTGTCTCCAAATAAGCAAAGCATCTTCCATAGTTGCACAAATATTTGCAGTATTTATTCCTATTTTTAAAATTATTATTATTAATTCTGATTATTTCTAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5745
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114481 Essential Splice Site 2952 3522 55 65
ENSDART00000146664 None None 375 None 7
ENSDART00000114481 Essential Splice Site 2952 3522 55 65
ENSDART00000146664 None None 375 None 7
Genomic Location (Zv9):
Chromosome 5 (position 41694785)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 39469502
GRCz11 5 40069655
KASP Assay ID:
554-3250.1 (used for ordering genotyping assays)
KASP Sequence:
AACCGCCACAATTGGATTCATTAACAACTTTGGYCAGATCCCGAAACAGG[T/C]TTGYGATTTCATTTTCCAAAATCTYATAAACATTTTCCAGTGAATWGCGT
Long Flanking Sequence:
GGTATGTGATCTTTTGTGGCTGCAAAAAACCCATATTTAAAAGTAAAGGAATTTTCTAGAAGTTGAATACAACCTCAAAACATTTTAGACATTTACACCTGTTTTTACTGTCAAACACTTGTGACTCAATAGATGAAATTCACATCTTTGTAATTTAAGGCACCATTTACAGCTGATATTTATTTCCGAAGATTCCAAGAACCACAGCAAAGGCCTCCAGAAACATGTTAATAATAAACATTTTGTTTCTTTTTTAATTTTTGTTTTGTTTTTTGTTTGTTTTCAGGCTCTGGAGTGTGATTATGTCAGTGCCCATCTGCATGAATGGATCGACTTGATCTTTGGTTATAAGCAGCAGGGTCCTCCAGCAGTGGAGGCGGTGAATGTCTTCCATCATCTTTTCTATGAGGGCCAGGTGGACATCTACAACATCAATGACCCACTGAAGGAAACCGCCACAATTGGATTCATTAACAACTTTGGCCAGATCCCGAAACAGG[T/C]TTGTGATTTCATTTTCCAAAATCTTATAAACATTTTCCAGTGAATAGCGTCTTCATAAATCTATTTAAAGTCACAGTGACATCAGTTGAGTAAAGTAATGGAAAGGAAAGTTGTAATTTGTCTCATTTAATCTAATTATGTTCATGCAATATGTGTGACTTGTGACTTGTGTGAATATGTGGGTGTTCAAATAAATTTTCCGAGCTCTTTGCAGTAATTTGTTTTATATGTGGAGCAGTAGCCTGAATAAACATGTGTGTCCTTTCTTTTAGCTGTTCAAGAAGCCTCATCCTCCAAAGCGTGTGCGCAGTAAGTCAAACGGAGAGGCGCCTGGAGGGCCTGTTACACTCAATTCCACATTAGACAAAATCTTCTTCCATCATCTGGACAATCTGCGGCCCTCTCTCACCCCTGTCAAAGGTAATACAGGTTATGTAGTCTATGAGTTATGAGTTTTACATTGGTACTTCATACTGGGTGTTTTGTCTTTTGGTTTGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2246
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114481 Essential Splice Site 2952 3522 55 65
ENSDART00000146664 None None 375 None 7
ENSDART00000114481 Essential Splice Site 2952 3522 55 65
ENSDART00000146664 None None 375 None 7
Genomic Location (Zv9):
Chromosome 5 (position 41694785)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 39469502
GRCz11 5 40069655
KASP Assay ID:
554-3250.1 (used for ordering genotyping assays)
KASP Sequence:
AACCGCCACAATTGGATTCATTAACAACTTTGGYCAGATCCCGAAACAGG[T/C]TTGYGATTTCATTTTCCAAAATCTYATAAACATTTTCCAGTGAATWGCGT
Long Flanking Sequence:
GGTATGTGATCTTTTGTGGCTGCAAAAAACCCATATTTAAAAGTAAAGGAATTTTCTAGAAGTTGAATACAACCTCAAAACATTTTAGACATTTACACCTGTTTTTACTGTCAAACACTTGTGACTCAATAGATGAAATTCACATCTTTGTAATTTAAGGCACCATTTACAGCTGATATTTATTTCCGAAGATTCCAAGAACCACAGCAAAGGCCTCCAGAAACATGTTAATAATAAACATTTTGTTTCTTTTTTAATTTTTGTTTTGTTTTTTGTTTGTTTTCAGGCTCTGGAGTGTGATTATGTCAGTGCCCATCTGCATGAATGGATCGACTTGATCTTTGGTTATAAGCAGCAGGGTCCTCCAGCAGTGGAGGCGGTGAATGTCTTCCATCATCTTTTCTATGAGGGCCAGGTGGACATCTACAACATCAATGACCCACTGAAGGAAACCGCCACAATTGGATTCATTAACAACTTTGGCCAGATCCCGAAACAGG[T/C]TTGTGATTTCATTTTCCAAAATCTTATAAACATTTTCCAGTGAATAGCGTCTTCATAAATCTATTTAAAGTCACAGTGACATCAGTTGAGTAAAGTAATGGAAAGGAAAGTTGTAATTTGTCTCATTTAATCTAATTATGTTCATGCAATATGTGTGACTTGTGACTTGTGTGAATATGTGGGTGTTCAAATAAATTTTCCGAGCTCTTTGCAGTAATTTGTTTTATATGTGGAGCAGTAGCCTGAATAAACATGTGTGTCCTTTCTTTTAGCTGTTCAAGAAGCCTCATCCTCCAAAGCGTGTGCGCAGTAAGTCAAACGGAGAGGCGCCTGGAGGGCCTGTTACACTCAATTCCACATTAGACAAAATCTTCTTCCATCATCTGGACAATCTGCGGCCCTCTCTCACCCCTGTCAAAGGTAATACAGGTTATGTAGTCTATGAGTTATGAGTTTTACATTGGTACTTCATACTGGGTGTTTTGTCTTTTGGTTTGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14824
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114481 Essential Splice Site 3417 3522 63 65
ENSDART00000146664 None None 375 None 7
Genomic Location (Zv9):
Chromosome 5 (position 41679720)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 39454437
GRCz11 5 40054590
KASP Assay ID:
554-5050.1 (used for ordering genotyping assays)
KASP Sequence:
GCAAGGACAACGCTCATCCTGCCGAAATCACCGCTCTTGCCATTTCAAAG[T/C]AGGCGCTTTGTGTGTTCTGTGGGGAAATGAGAATAAAAGAGAAGAWGTTT
Long Flanking Sequence:
AGAGATGGTGGGGAACAGTGGAATTAAGTAAAGTGCTTGTCTGGTCTGAGAACCACTTTATATCATATATCTACAGTATCAGGCAGTGAAGATCACTGATTTTTAAAGAAAGCACATCTTAATTGTGGTGATTTTTGTAAGGGAAAGTTCATTGGAAGCCATTGGGCTGGCTGGTTGAAAAATTAGAAGTCTGTGTGGATGTATGATATTGTGCATTGTGAAAGTTTGCTGAGGGCCACTGAGAAGCACTGAGAAGATCAGTAAATCCTAAAATTAAAAACACATTGGTGTATTCATTTAATAATCATTCAAAGGCTGTTCTCTTATGGTGTAGGAATCTTCTGATATTGTTTATGCAACTGGCAGTTTGCTTTGTGTCCTGTGCAGGCTACAGATGGGAGAGACAGCTGGTGTTTCGGAGCAAACTCACCATGCACACCGCGTTTGACCGCAAGGACAACGCTCATCCTGCCGAAATCACCGCTCTTGCCATTTCAAAG[T/C]AGGCGCTTTGTGTGTTCTGTGGGGAAATGAGAATAAAAGAGAAGATGTTTTCTGCTGTGCTTTTTATTGTTACTTAATAATAACACTGTTTGCACAGAGGATATCTAATGAATTTTGTGCAAACAAGGAAGAGGGCTGACGGCAAGCTGTTGTTGTGTTTTCAGAGACCACAGTAAGATTCTGGTAGGTGACGGTCGAGGGCGAGTGTTCAGCTGGTCAGTGAGTGATCAGCCGGGTCGCTCTACTGCAGATCACTGGGTGAAGGACGAGCAGGTGGACAGTTGTTCTGGGTGCACCGTCCGCTTCTCCCTCACCGAAAGACGCCACCACTGCAGGAACTGTGGACAGGTCTTCTGCCAGAAGTAAGGTTATGTGCAGTAAAATGTATCATGTGCAAACAACACAATTTAATTAATGAATGAATTGGTTTATTTAAATTTTATTAGTTTATATAATTAATATTTTAGAATAAAAGGACTACTTCTGTTGCTGTTTTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6996
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114481 Essential Splice Site 3417 3522 63 65
ENSDART00000146664 None None 375 None 7
Genomic Location (Zv9):
Chromosome 5 (position 41679720)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 39454437
GRCz11 5 40054590
KASP Assay ID:
554-5050.1 (used for ordering genotyping assays)
KASP Sequence:
GCAAGGACAACGCTCATCCTGCCGAAATCACCGCTCTTGCCATTTCAAAG[T/C]AGGCGCTTTGTGTGTTCTGTGGGGAAATGAGAATAAAAGAGAAGAWGTTT
Long Flanking Sequence:
AGAGATGGTGGGGAACAGTGGAATTAAGTAAAGTGCTTGTCTGGTCTGAGAACCACTTTATATCATATATCTACAGTATCAGGCAGTGAAGATCACTGATTTTTAAAGAAAGCACATCTTAATTGTGGTGATTTTTGTAAGGGAAAGTTCATTGGAAGCCATTGGGCTGGCTGGTTGAAAAATTAGAAGTCTGTGTGGATGTATGATATTGTGCATTGTGAAAGTTTGCTGAGGGCCACTGAGAAGCACTGAGAAGATCAGTAAATCCTAAAATTAAAAACACATTGGTGTATTCATTTAATAATCATTCAAAGGCTGTTCTCTTATGGTGTAGGAATCTTCTGATATTGTTTATGCAACTGGCAGTTTGCTTTGTGTCCTGTGCAGGCTACAGATGGGAGAGACAGCTGGTGTTTCGGAGCAAACTCACCATGCACACCGCGTTTGACCGCAAGGACAACGCTCATCCTGCCGAAATCACCGCTCTTGCCATTTCAAAG[T/C]AGGCGCTTTGTGTGTTCTGTGGGGAAATGAGAATAAAAGAGAAGATGTTTTCTGCTGTGCTTTTTATTGTTACTTAATAATAACACTGTTTGCACAGAGGATATCTAATGAATTTTGTGCAAACAAGGAAGAGGGCTGACGGCAAGCTGTTGTTGTGTTTTCAGAGACCACAGTAAGATTCTGGTAGGTGACGGTCGAGGGCGAGTGTTCAGCTGGTCAGTGAGTGATCAGCCGGGTCGCTCTACTGCAGATCACTGGGTGAAGGACGAGCAGGTGGACAGTTGTTCTGGGTGCACCGTCCGCTTCTCCCTCACCGAAAGACGCCACCACTGCAGGAACTGTGGACAGGTCTTCTGCCAGAAGTAAGGTTATGTGCAGTAAAATGTATCATGTGCAAACAACACAATTTAATTAATGAATGAATTGGTTTATTTAAATTTTATTAGTTTATATAATTAATATTTTAGAATAAAAGGACTACTTCTGTTGCTGTTTTTTTT
Associated Phenotype:
Not determined