Busch Lab

ZMP

si:dkey-20i10.6

Ensembl ID:
ENSDARG00000078887
ZFIN ID:
ZDB-GENE-090313-231
Description:
probable phospholipid-transporting ATPase VD [Source:RefSeq peptide;Acc:NP_001139079]
Human Orthologue:
ATP10D
Human Description:
ATPase, class V, type 10D [Source:HGNC Symbol;Acc:13549]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa42153 Nonsense Mutation detected in F1 DNA Not yet available
sa22247 Nonsense Available for shipment Available now
sa35435 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa6288 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa42153
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086525 Nonsense 81 1365 1 22
ENSDART00000108543 None None 1361 None 21
ENSDART00000143557 None None 1228 None 21
Genomic Location (Zv9):
Chromosome 13 (position 12265207)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 12263575
GRCz11 13 12396050
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGCAGCTTTTCCAAAGGCTTCCAGAACAACAGCATCCGGACCACCAAATA[C/A]ACCCTCATCAGTTTCATCCCCATGAATCTGTTCCAGCAGTTTCACAGGTC
Long Flanking Sequence:
CTAAGTGTGAACTCTTGAAATAAGATTTCATTTATTTCAACTCCTTCCTCTTCCCTTGGCACAGGGAAGTAAAATGAACTTCTGCCTTCACTTTTTTATTGCAAGTTAAACCTGTTCAGCTGTTATTGTTTGTGTTGTTGTTTTTAAATGGAGAATTATCAGGTTGAATGCTCTTCAAATTTATAGTAATTTTCTGCCTGTTTAGGTCTGTTTGTAGTGCAGACGTGGACTACGCTATTTCGTCTTGCTGCTGTCCTCATGGAGCGGCTCCGCTGGGTTCAACACCGATGCCTGCAGCTGATATCCACAGACAGGCGGAGAGGCTGGTACTCTTCTCCTTCATCACTTCCTCCTAAAAGTAGCCAGGATGCTCAGGACCCTCAGGTTCAGCGGCTCAGTGGGAAGAGAAGGGTGGTGGTATCACGATGGGACCCGCATCATTCAGAGTACCGCAGCTTTTCCAAAGGCTTCCAGAACAACAGCATCCGGACCACCAAATA[C/A]ACCCTCATCAGTTTCATCCCCATGAATCTGTTCCAGCAGTTTCACAGGTCAGATGTTGAGCTGAATACATCATTGTCTGAGTAATTTCATTGTGTGTTTTTGTGTGTGAGAGTTAATGACACATTTTGTTTTCTTGCAACAGAGCCGCAAATCTGTACTTCCTATTCCTGGTGCTGCTCAATTGGGTCCCAGCTGTTGAAGCATTTCAGAAGGAGATTACCATGATCCCCCTGGCAGTGGTGCTTACCGTTATTGCCTTTAAAGATGCCATGGAGGACTACAGACGATACCGCTATGACAAGAAAATAAACAACACGCTGACGCATGTCTACAGCGGGTCAGTATTTGTTCTTTCATGTTTATCTGGTGTGATCGGGTTATCTGCGGTTTTATAATTGCATGTTTTTGTTTCCATGTGGGGGTTTTCAGTGTAGAGTTTCACAACTTCCTTTACTGCACTACACATAATACCTTTTTTTTCTTTTTTTTTTCCACCACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22247
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086525 None None 1365 None 22
ENSDART00000108543 Nonsense 31 1361 1 21
ENSDART00000143557 None None 1228 None 21
Genomic Location (Zv9):
Chromosome 13 (position 12274452)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 12272820
GRCz11 13 12405295
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTAAAGACAGTGTCTTTGGAGCGGAAAAGTCCAGCTGCCATGATTCAAT[C/A]AGTGGACGGAGATCAAGGAGGTACAGCTAAAGATCTGACCAAAAGCAGAA
Long Flanking Sequence:
TAATAATAATAACAATATCAACCTGGGCTTCAAAAGTCCAGAGATCCTCAAATTATAGGTACAGCTTGCATTTTCCATCCGAGATAAACGTCACACTACAAAATGGTCATTTATTTACTAGCTCTTGGATTTCTCGGTCTGAAAGCTGCCTCTGACTCATAAAAGTCTCAGTTTAGTTTGTTTATGATGCTTGGGAGTGTTTCCTGGATAAGGAGCGGCCAATCTGTATGTTATAGATCATTACAGGTTTCTCAGCCACACTCACACACACACACACACACATACACATACACATACACTAGAGTTGAGACAAAGGTTTTGAAGAGCATAACACTTCTCAGGTGTCACATCTTGGCTTGGACTGAATCAAAAACATGAATTTAACTAGTGATGGTGAGACCTGTTGGACATGATTGGGATTGAGAAACTGCCAGAATTGGCTGGACCATTTTTAAAGACAGTGTCTTTGGAGCGGAAAAGTCCAGCTGCCATGATTCAAT[C/A]AGTGGACGGAGATCAAGGAGGTACAGCTAAAGATCTGACCAAAAGCAGAAGGGTTATCTTGCCAAGTTGGACTGAAGACGAACAGCTAAAGGAATTACAGCAGTCATACAGCAAGAATAAAGTCCGGACGACCAAATACACCTTCCTGTCGTTCATCCCTAAGAATCTTTTCGAGCAACTCCATCGTTTTGCCAATGTATACTTTGTCTTCTTGAGCGCGTTGAACTTTGTGCCTATTGTGAATGCATTCCAGCCGGAGATCTCGATCATTCCTATTATTTTTGTGATGTCTATTACTGCTATCAAAGACCTCTGGGAGGACCAGCGTCGGAGGAAGTCTGACCAACAGGTCAATAACCGCTTTTGCGATGTGTATGACAGGTAAAACAATTGAGAATATAGATGTAACAAACACAACCTGTAGCTACTTACATCAGTTTGGGCTTTAACCATGTGCTGTAAGTGAATCATGGCAGTGCATACATGCATCTAGTGGTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35435
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086525 Essential Splice Site 803 1365 11 22
ENSDART00000108543 Essential Splice Site 799 1361 10 21
ENSDART00000143557 Essential Splice Site 666 1228 10 21
Genomic Location (Zv9):
Chromosome 13 (position 12298471)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 12296839
GRCz11 13 12429314
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGTTTATACAAAAGGAGCAGATAATGTCATTATGGAGCTAGCTAAACAAG[G/A]TAAGTGAGGTTATGTTCTTGCTTTACTAAAATCATTTTTCACAGGACAAA
Long Flanking Sequence:
CTTCGCCCGGGGGCGTTCGGCTTCCTACTTCCCAAACAGCAACCCACAAACCCCCGTCACACCCTTAGAGTCACCTGTCAAACTCTCTGGCACTCCATCAGACACTCCACCAGCTCTCATCACTCCTGCTCTGTCGTCCAGCGGGGCATGGGGCGAGGATGCGGAGGACAAAAAACAAGCCAAAGATAACGCTGCAGATGAATCTGAGAGCGATGATGAAGATGAGGAAGAAGAGTTGCTGTACGAGGCGGAGAGTCCCGATGAGGCGGCATTGGTGCAAGCAGCAAAGGCTTACGGATGCACTCTGCTGGGCCGGTCCCCAGAGCAAGTCCTCGTGGCCGTTCCTGGCACCGGACCGCTGTCTATCTCTCTGCTGCACGTACTGCCGTTTCATTCTGCCCGCAAGAGGATGTCTGTGGTGGTGCGCCATCCCCTCACTGGAGAGGTGGTGGTTTATACAAAAGGAGCAGATAATGTCATTATGGAGCTAGCTAAACAAG[G/A]TAAGTGAGGTTATGTTCTTGCTTTACTAAAATCATTTTTCACAGGACAAAAAAAACATCAGCATTTCAGATGTTGCCAAGTGTTAGGTTTAAGGTAATACTGGTAATACTCTAAGAAACGATGTAATACCTGAGCAGGGGTATACTCTTAGCTAGCAGCTTGACATCACCCACAATAAGTGGGTTTAGATCAAAAACAACAGAAAAAAGGAAAACAGCAGTTATGACGTCATCTGTTAATGATGATACTTAGAGCTGTGGCGCAGGATTGTTCGAGAATTCAGTTTAGAGATTTTAAAAATGCATCACTATTCTCTCTTGAATCAATTCTGAGCTTCGTTTTTAACAGCAGATGGTGCTGTAGGCTTGTTTTTAACTGTATAATTCAATTCAATTCAATTCAATTCGAACTGTATACTCAAAAGCTCACGAGGAAGAGCATTTGTGCGTTCCGTTTAAAGGGCAGCAATGATGTGCTCAAACTTTTTAGCATGAAGGGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6288
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086525 Nonsense 1076 1365 17 22
ENSDART00000108543 Nonsense 1072 1361 16 21
ENSDART00000143557 Nonsense 939 1228 16 21
Genomic Location (Zv9):
Chromosome 13 (position 12312836)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 12311204
GRCz11 13 12443679
KASP Assay ID:
554-4613.1 (used for ordering genotyping assays)
KASP Sequence:
GTCCAGTGACTTTGCCATCTCTCGATTYAAGTTCCTGAGAAAGCTGATTT[T/A]GGTTCATGGTCATTGGTGCTACGCCCRTTTGGCTAACATGATCCTCTATT
Long Flanking Sequence:
TGAAGAATCCACTCTACTTTTCTTCAGGAAATTATCCAGATGTTAAATTAATAATATGTATTTAAATAAATCACATTTTACTGCCTAACTGCTGTTTTACTGTTACATTCTTTAATTGAACCCAAAAAAAGGATATTTTGAAGCATGTTGGTAACCATTAACTTTCATATTTTTTTGTACTCTGTACCATTTTTGAAACATTTTTCAAAATATCTTCTGTTTGAAACCACTTACGTTTTTCACTTAGCACTTTTTGGGGGGTGAGCTGTTCATTTATATGAATTAAAATGTATACTATTCCCAATCTATGGTTCATTTTCTTATTTTAAAGAGAAACAAAATGCACTTTACCTTACCATCCTACCTAGTTTGAATCCTTTCAGTTACATTTATAGTTAAAGCATCTCTAACTGTGTATGTTGTCTTTTCTGTCCATATATAGGCAGTGATGTCCAGTGACTTTGCCATCTCTCGATTCAAGTTCCTGAGAAAGCTGATTT[T/A]GGTTCATGGTCATTGGTGCTACGCCCGTTTGGCTAACATGATCCTCTATTTCTTCTATAAGAATGTGGTGGGTAATGCACAAATTTACACAGTTCCTCATACAGCCGTTATCTTGCAGTCCTGACTCGTTCCTCTTCTTCTTTTTTTCCTCTCTGTTTATGTAGATGTATGTGAACCTGCTGTTCTGGTACCAGTTTTTCTGTGGATTTTCAGGCAGCACCATGACCAACTCCTGGGTCCTAATTTTCTTCAACCTGCTCTTCACCTCTGTCCCTCCACTCGTATACGGTGTGCTGGATAAAGATGTGTCTGCAGAGACGCTCCTAAAACTGCCTGATCTCTACAAGTCTGGACAAAACTCACAGGTGGTCATTTTGTCACACACAGCGTTTCTGTTTTTCATGTTCAGCTCATCAGGTGTTTTAGATATGGTCTGAAAATATTGATGACTTTTGTGTGGTTTTCAGGCTTATCTTCCAACAACCTTCTGGCTGAACATT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4493
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086525 Nonsense 1324 1365 22 22
ENSDART00000108543 Nonsense 1320 1361 21 21
ENSDART00000143557 Nonsense 1187 1228 21 21
Genomic Location (Zv9):
Chromosome 13 (position 12320105)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 12318473
GRCz11 13 12450948
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAGCACAGAAAATAGAGAGACTTTCTGCGCAAGACTATTCCTCCAGTTTA[C/T]AGAARTGGAAGGAGAACAAMGCCACTCAAAGKGTGTCCTCAAGACCCGTC
Long Flanking Sequence:
GCTGCACACTGGTGGTGGATGAGGAGATTCCCCCCCCCATTGTGTAAAGCACTTTGAGTGCCCAGAAAAGCGCTATATAAATGTAACGAATTATTATTATTATTATTATTAATATATATGTACTCAAGAAAGCTGGGGAAAAAACATCCACTGACTTCCATAGCATTTTTAATTTTTTTTTTGTGTTAAATTTTATTCAAGTCAGTGGCTGCTTTTTTCCAACATTGTTTCGTGCTAATAAATGCATAAAGTTTAGAATCACTTTAGTATGAGTAAATGGTGAGGACATTTTCATATTTGGGTGAACTACACATTTAATTTGAATTTAGCCTAACTTTATTGCAGACGTGTGATTGTTAATGATGGTGCAATATATTGTTTATTTCTTTCTGTGTCACAGGATGCTGTCTCGTGCCTTCTCTAACACTATTTGTCCATCTGACCTGGTGAAAGCACAGAAAATAGAGAGACTTTCTGCGCAAGACTATTCCTCCAGTTTA[C/T]AGAAGTGGAAGGAGAACAAAGCCACTCAAAGGGTGTCCTCAAGACCCGTCCCCCAAAACCTCAGTGTGAACGCTGACATCCCCAGTTTAACAGAATGTGCTGCTGAGGGAGGCGCCGTTCTCTCGTGACCAATAACAAAGTCGCCTTTGATCATACAAACATGGTCATTCAATTAAATAGTGGCCATATATGCTTGCACTTTAATGATAGGCAGATTCTCTGGCCAGTTAGGATCCAGAGCTGGCTTTCCTCTGCCCAGTAAGAGTGTTTTCAGAATGAACTGCATCGCAAACTCATTCTCGTTCTCGGATCGCAGAACGATTTGGATTCTTGGAGTCTGGCTTTTGGAGTCAAAAGAAATGCCGAGAACTGTTTACATTTCACATGGCTGTGCCTGTGACACTTTTATAGAATTAAACACACACACACTCCCGAATAACACTGAAACTTATAAGGGTGAATTGTTTTGGAGGGTGTGACCAAGATAATGTGGCTACTTA
Associated Phenotype:
Not determined