Busch Lab

ZMP

wu:fj21g01

Ensembl ID:
ENSDARG00000078872
ZFIN ID:
ZDB-GENE-030131-7496
Human Orthologue:
TRAK2
Human Description:
trafficking protein, kinesin binding 2 [Source:HGNC Symbol;Acc:13206]
Mouse Orthologue:
Trak2
Mouse Description:
trafficking protein, kinesin binding 2 Gene [Source:MGI Symbol;Acc:MGI:1918077]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa9096 Nonsense Mutation detected in F1 DNA Not yet available
sa20616 Essential Splice Site Available for shipment Available now
sa20615 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9096
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112204 Nonsense 38 974 2 15
Genomic Location (Zv9):
Chromosome 6 (position 4087112)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 4055777
GRCz11 6 4216597
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGTAAGGTGTGTGACGGGGGTGTCAGCGGGTGTGGAGAGGATTYGCTGTA[T/A]CTTTACGAGGGTCAAGATTGGGTCATTTCTCCATCCTGCTCTCCAGACGA
Long Flanking Sequence:
GTTTACTAATACACTAATAACGTCTAATACTGGAATATATTTGAAAGGATATGCTGGTTATCAGGTGCTAAAACACACATTCACATTCTCCAGGCTGTGTAATTACCCATAAGGCATCACATGTAAATGCGAATGGTCATGTGCTGATGTGTCGTCTTGAGATGGTCAGTGTGAGTCATGTGGTGTGGAATAATTCTACAATGCTCCCATTGACTCCTATTCATTTTCTACATTTTTATAAAGCCTCTTTTGAGGGACTTTGGAGTTCTGAATGTTCCTATTTCACTTTTATTTCTCCAATCATAACCAATAATTGAAATTCTGACTCTGTAATAGGACTGACTGTGTCTTTTTTATGAATGAACAGCAGATGGTGTGCATGAACTTGTGTGTATCTATGTGAAATTGACTGAAGCTGGATGGTTTGTGTGTGTGTTTTCAGATGAGGGCAGTAAGGTGTGTGACGGGGGTGTCAGCGGGTGTGGAGAGGATTCGCTGTA[T/A]CTTTACGAGGGTCAAGATTGGGTCATTTCTCCATCCTGCTCTCCAGACGAGCCCAGCGCCATCTCACCAATGCTGGCTGAGGAAACCTTCCGCTACATGAGTAAGTCACTATGTGTGTGTGTGTGTGCATGAGTGTCTGCATGCTATTTCTGTCAGGACAGTCATTGCAAACTTAAAAGGTCTTAATGTCAACATTTTATGGCTTAAAAGGTCTTAAATTGAATGAAATATTTTGTTATAGGACTTAAATCATTTTAAGCAGGTCTTAATTTTCCCTTGTCCATGAAAAGTTACCCAGTCAGGCTAACCCATCACCAATAATCTCAATAAAAATTTGAACAAAAGTTAAATATTTAACTCTATTCATAAATGTGGTGTAATTATCTTCTTTGCAATAACTTTTAAACGTTTAAGAGTTCTCCATGATTACGACAGACAGATATTGTTGTGCGTAAATGTAGATAGTTTTTAAAACTTATTTTAACTAGATTTAGCCTGTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8367
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112204 Nonsense 97 974 3 15
Genomic Location (Zv9):
Chromosome 6 (position 4074762)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 4043440
GRCz11 6 4204260
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGATGACCAAGACCTACAATGACATTGACGTGGTCACACACCTCCTGTCT[G/T]AAGTGAGTGATGCTGATTGGTCAGCAGKCTTTTGATTATGCACTTTGTCT
Long Flanking Sequence:
AGCTTTTTCCGTGTCACATGATCCTTCAGAAGTCTTTGTTATTTGCTGATTTATAATCAATATAAATTGATTTAGTTTTCGTGTCATTATAACATTTTGGTACATATAATCTTCTCTGAAAATAAGCATAAACCACTTTATATCCCAGAATTTTTACTGTAGAGTATATAGTGCATGAAGTTAATAGATGATCTGAATTGATGTTTGTTTTGGTATCGCACTTTGGGTTTGTGCATGATGTTATTGTAATGGTGTGTGGTGCATGTGCATAGCTTGCCATATGGCACATGGGTGTGTTCACACCCTACTGTTTTGGTCTCAATAGAACTGAATAGAAGATCAGTTATATCAAAGCTAGCATAGTGTTTTTGTTTGTTTTAATGCACTCTCTCATTTTGTTTGCCCATCTCTGTTTTCTCTCCATAGTCCTCAGCGCTGACCGGGTGGAGCAGATGACCAAGACCTACAATGACATTGACGTGGTCACACACCTCCTGTCT[G/T]AAGTGAGTGATGCTGATTGGTCAGCAGGCTTTTGATTATGCACTTTGTCTAGTTTGGTTTTGATCATAACGACTCCTGATCGTCTGTCTGTGTGCATTATGGTGTGGTCCCGCAGAGGGATCGCGACCTGGAATTGGCTGCACGGATTGGTCAGTCTCTCCTGCAGAGAAACCATGTGCTGCAGGAGCGAAACGAGTCTCTGGAGGAGCAGCTGGCACAGGCTCTAGATCAGGTAAATATATACAGCTAAACCTGGATAATCAGGGCACAATGCAGTCAAAAAAGCTGAATTTGTGGCATAAAAATGGAATTTACGGTTAAACATTGAATGTTATTAGCAAAATTTGGATTAATAAATCAAAGATATACTAAAATTGCAGTACAGACTATAGTGTTATTGAATATTAGACTGTAAAATACAGCCAAAATAATATTAAATATACATTTTCACAGAATTGTATTGTAAAGTAGACTTAACTAAGTAATTATTACAATAATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20616
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112204 Essential Splice Site 206 974 5 15
Genomic Location (Zv9):
Chromosome 6 (position 4073805)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 4042483
GRCz11 6 4203303
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCCAAACTGCAGGATCTGGAGGAGGAGAACCTCACCCTCAGATCAGAGG[T/C]GCGCCACTGACTCCTCAGCGAGTATATGTAAGGGATAAAGTACATCCAGG
Long Flanking Sequence:
TGTATTGTAAAGTAGACTTAACTAAGTAATTATTACAATAATAAAATGATTTAAACTTTAAGGATTTTCTTCCATGCTTTAATTTGAACTGTAGGCCTATTTTAAAGTACTTTGCTTGACAAAATATAAGACGTTTTTAGTCAAATTACTAATGGCTTGTTCGTTTTTTATGGTTTTATTTAATTACCTCTGTTTTTATGATAATAAACTGATAATAAAAGTGAAATTTTGATTTGATAGGGCCCTTTAAATACTACAGCATTTATAAGACACATGCTCTCCATCTCAGGTTCATCAGCTTCAGCACGAGTTGGCGAAGAAGGATGAGCTCCTGCGAATGGTTGCGAGTGCCAGCGAGGAGAGCGAGACAGACTCCAGCTGCTCCACACCGCTGCGACACCCGGTGCCTGCAGGGGCCGCTCTCGCTCTCAGCCAGCTGGAGGCCCTTCAGTCCAAACTGCAGGATCTGGAGGAGGAGAACCTCACCCTCAGATCAGAGG[T/C]GCGCCACTGACTCCTCAGCGAGTATATGTAAGGGATAAAGTACATCCAGGTGGTTGTTACTGAAGTATAAAGCTTGACAGGTTTATCGGCAGCCTGATCTGAAGCGGAGCACTGTTGTGTAAGACTAAAGGGCTTATTCTGCGAAAACAACCATTCTGGATGTACTTTATCCCGCTTATTACAAGGCTACTTGCCACAGAACATAAAAACTTAGCACAAAGCATTGTTCTGAGACATAATAGATTATTAATTCTTTAATTAAACGCAATGCTGACTTAAACGAAAGCAGCTGATGGAGTATACACTAACCTGTGCATTATTCAGACACAAGATAGCGCTAAACAAATGCAAAACTAACATTACCTGCCACAAAACATACAAATTTGACAGAAAGCATTATTCTGAACTATAATTGATTTATTCTTTAATCAACCGTAAAGCTGACTTAAACGAGAGCAGCTGATGGAGTATACACTAACATGTGCATTATTCAGACACAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26665
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112204 Essential Splice Site 301 974 8 15
Genomic Location (Zv9):
Chromosome 6 (position 4067603)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 4036281
GRCz11 6 4197101
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAATTCACCTTCAGGCCTCAAAGGAAGCACAACGTCAGCTCACCAATGAG[G/T]TAAAACTACACACACACATACTGTACAAACAGCTTTACAACCTCAGATCT
Long Flanking Sequence:
GAATGCCGCAAGTGTACCTGAAGTCACGTGACAAGAACTGAGCGATCAGCTTCAGCTTGTAAGGAATATACACATTTCTGTAGACTATTATCTTGGACAAACACCCAAACACTGCAGTGCTTTGTAATGTTTTCCATAAATAAAACTTGTATCAGAGTGACAGCAGTGTTTTGTCAGCTTGTCATCCTCTGAGAAAGTGGTTGATGGTCACCTAGCAACCTACAAATGAACACCACAACCACCCCCACACCATCCATGGTAAAACTGTCAAGCATTGCCCAGTCATTGGTGATAAAGAGGTTGGAGGCCACTGATCTAGAGCATGAGAGACGACTTATAAAAACATGAAAAGATCTCACAGCCCCATAAACATTTAAACTGAGTGTATGTGGATGTATAACTGTAGATGTGTTGTGCTTTCTCAGTTGGCGCTGGAGAAAGAAGAGCTGCGAATTCACCTTCAGGCCTCAAAGGAAGCACAACGTCAGCTCACCAATGAG[G/T]TAAAACTACACACACACATACTGTACAAACAGCTTTACAACCTCAGATCTGGATTAAATCTGATTTATAAGGCCTGTTTGTTTCTTTAATGGAAGGTTAAGGGCCTCTCGTGTGGAGTAAAGCATTTAAAACATGATTTAAAGGTTGTGTAAAAAGCAGCTTAGTCACTGTGACTTAGAAAGTGTAGCAATATTCAATCTTATGATGTGTCTCTTATCATTGCACCATTGAACCATAAAGGGCAGGAGTGCTATAATGTGTCACAGGACAGTGTGTACATTTCACTGGAAGATTTACAATGGTAAAGCAATTAATCTTTTTGCACATCAGCATATTGGACTGTCTGCTGTAGACCTACATATGGGAATATTTTGGGGTAACCCTTTAGTTTATGTACCAACCAATGGGTTCAACAGTGAAACGCAGAAAACGCCGGGTTTTAAACCACAATAACATCAATTAATCTTGCAAATGAGTGCCTCTACGTGATGCTGGAGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20615
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112204 Nonsense 389 974 11 15
Genomic Location (Zv9):
Chromosome 6 (position 4062505)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 4031183
GRCz11 6 4192003
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACTGAAGGTCGTCCCAGAAGCGTGTGTTCCAGACTGTGCGCTCCGTCAAT[C/T]AGTCAGTGATGAGAGCAGCCGCTGCAGGCCCTCCTATACCCGGCAGCGGT
Long Flanking Sequence:
TAAATTGTTGATATCGGCTGTCTTTGACTTTTATTGAGGTTATGAATTTGATCAAAGTCTGATTCGGGGGCTGGGGGGATATGGAAAATGAGGCTTTCTGACCAAAATGTCTCAATGAAAGAAATGAAATAGATGGTTATTAGGGAGATCAAATTTAGTTGATAGGAGTAAAAACATTATTCCATTTTTTTATTTATAACTTAAGCTCTCTTACTGTTGTAAAACCTTTTCTTTGTTTTTAAAACCAATACATAAAATAATCATTGCCCTCCTTTTGTCCATCAGGATTCTATAGCAGCTGAGATTGAAGGTACTATGAGGAGAGAGATGAGCGTAGAAGAAGAAATCGCCTTTGAAGACCAGAGGTGACAACTTATCCCTCACAACTCTCTCACACACACTCGTATATCTATAGGTTTCCACCATCACTGACCTCTGACTTTTCTGTCCACTGAAGGTCGTCCCAGAAGCGTGTGTTCCAGACTGTGCGCTCCGTCAAT[C/T]AGTCAGTGATGAGAGCAGCCGCTGCAGGCCCTCCTATACCCGGCAGCGGTGTGATCATGACCCCGGTGCCCTATCAGTCACACACACACAACACTGCAGATGAGGACGCCAGCAGGTCAGAGTCACCGCACACTGCGTTCATAGTGCAAACAGACTGTTAACAGTACAATATGTATGATTTTTAACATTAACATATGCTTTGTTTGTTGTGAATACATGCCCTCTAGTGGTGAAAATGAAACACTGTATCTTTATAAATTAATATAATCAATAATCATGGGCAGATTTGGATAAATACATCTGTAAACAACAATCCATCATGGGACTATTTGTAAATATACGTCTGTAGTTTATACCCACAATGCACTGGTGTATTTCTGACTCGCATATCCATGTGCTGCAGAGGGAGGGAGAACTCTCGTCTGGGTCAGCCCGGCTCTCCTGGAGGTAGTGCTCTGACATCAGCGCTGAACCGTCTGTCCCTGCGGAGGCAGAACTTC
Associated Phenotype:
Not determined