Busch Lab

ZMP

si:ch211-173o4.2

Ensembl ID:
ENSDARG00000078864
ZFIN ID:
ZDB-GENE-081105-61
Description:
si:ch211-173o4.2 isoform 2 [Source:RefSeq peptide;Acc:NP_001121728]
Human Orthologues:
CIT, LATS2
Human Descriptions:
LATS, large tumor suppressor, homolog 2 (Drosophila) [Source:HGNC Symbol;Acc:6515]
citron (rho-interacting, serine/threonine kinase 21) [Source:HGNC Symbol;Acc:1985]
Mouse Orthologues:
Cit, Lats2
Mouse Descriptions:
citron Gene [Source:MGI Symbol;Acc:MGI:105313]
large tumor suppressor 2 Gene [Source:MGI Symbol;Acc:MGI:1354386]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa38734 Nonsense Mutation detected in F1 DNA Not yet available
sa7627 Missense Mutation detected in F1 DNA Not yet available
sa38735 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa34612 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa38734
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110996 None None 1078 None 10
ENSDART00000111899 Nonsense 286 1140 5 9
ENSDART00000113352 Nonsense 286 1140 3 7
ENSDART00000139620 Nonsense 286 1140 5 9
Genomic Location (Zv9):
Chromosome 9 (position 22329427)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 21485213
GRCz11 9 21296082
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGGATACCCTAGTGGGATTGACCAGGCCATGATGGGGTACAGTGTGTCT[G/T]GACCACCCATGCAAATCCAGTCTCAGCCCTCAGGAGGGCCTGGAGCACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7627
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110996 Missense 584 1078 6 10
ENSDART00000111899 Missense 646 1140 5 9
ENSDART00000113352 Missense 646 1140 3 7
ENSDART00000139620 Missense 646 1140 5 9
Genomic Location (Zv9):
Chromosome 9 (position 22330508)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 21486294
GRCz11 9 21297163
KASP Assay ID:
554-4070.1 (used for ordering genotyping assays)
KASP Sequence:
GAGGGAGTCTCGTATTAAGAGTTATTCTCCATTTGCCTTTAAGTTCTACA[T/A]GGAGCAACATGTGGAGAATGTGATGAAGACATACCAGCAGAAACTTAATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38735
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110996 Essential Splice Site 611 1078 6 10
ENSDART00000111899 Essential Splice Site 673 1140 5 9
ENSDART00000113352 Essential Splice Site 673 1140 3 7
ENSDART00000139620 Essential Splice Site 673 1140 5 9
Genomic Location (Zv9):
Chromosome 9 (position 22330591)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 21486377
GRCz11 9 21297246
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCAGCAGAAACTTAATCGCAGAATGCAGCTGGAGCAAGAGATGTCCAAG[G/T]TAAGCTATGCTGGAACTGTTTATCACAAAGAACACCGTTTACTTTATAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34612
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110996 Essential Splice Site 866 1078 8 10
ENSDART00000111899 Essential Splice Site 928 1140 7 9
ENSDART00000113352 Essential Splice Site 928 1140 5 7
ENSDART00000139620 Essential Splice Site 928 1140 7 9
Genomic Location (Zv9):
Chromosome 9 (position 22331616)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 21487402
GRCz11 9 21298271
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTGGTGGGCACCCCTAACTACATTGCCCCTGAGGTGCTTTTGCGCAAAG[G/A]TAAGAATATTCACATAGTCACTCGGAAGTACAAGGACATTACAAAGAATT
Associated Phenotype:
Not determined