Busch Lab

ZMP

ASCC3 (1 of 2)

Ensembl ID:
ENSDARG00000078863
Description:
activating signal cointegrator 1 complex subunit 3 [Source:HGNC Symbol;Acc:18697]
Human Orthologue:
ASCC3
Human Description:
activating signal cointegrator 1 complex subunit 3 [Source:HGNC Symbol;Acc:18697]
Mouse Orthologue:
Ascc3
Mouse Description:
activating signal cointegrator 1 complex subunit 3 Gene [Source:MGI Symbol;Acc:MGI:1925237]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa39074 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa12811 Nonsense Available for shipment Available now
sa7238 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa39074
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114325 Essential Splice Site 369 761 7 16
Genomic Location (Zv9):
Chromosome 16 (position 2500779)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 1530431
GRCz11 16 1554319
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTATGTGCAGAAAGTGGCCATTCTCATCATTGACGAGATCCATCTTCTGG[G/A]TAAAGCGTCTGACAAAACACCACTAAAACTGCCTTCCCACTGCACAAACG
Long Flanking Sequence:
TCTTAATAAGGTTAAGTTCGGGTAATTAGGCAGGCCATTCTATAGCAGTGGTTTGTTCTGGAGACAATCCAAAACAAATATTGCTTAAGGGGGCTAATAATATTGACCTTAAAATGGGTTTTAAAAAAATGCTTTTATTCTGGCCAAAATAAAACAAATAAGACTTTTTGCAGAAGAAAAAATATTATAGGAAATCATGTTGAAAATTCCCTGCTTTGTTTAACATCCTTAGTGAAAAAATCACAGGAAGGATAATACTTTTGTCTTCAACTGTATCAGCGTATGTTACACCCTGACGCTTTATTTGCTGATGATCGTACTGTTTCTGTCTAGGGTGGTTGAGTTAACTGGTGACAATACTCCGGACATGCGAGCCATAGCACAGGCTGACCTGATCGTCACGACACCAGAGAAGTGGGATGGAGTGAGCCGCAGCTGGCAGAACCGCAGCTATGTGCAGAAAGTGGCCATTCTCATCATTGACGAGATCCATCTTCTGG[G/A]TAAAGCGTCTGACAAAACACCACTAAAACTGCCTTCCCACTGCACAAACGACAAGCCACAGACTGGAAGTCGCTAGCTGTTTGTTTTTAAATGTCTGACAGTTTTTAAATGTTATTTCTGTTATTTTTAAGTTTAATATTGGTTTCATTTTACCTTTATTATACAAATTTGACAATTTTTTGATTTGCTGGTAATAAAAAAATAGTATTGATAGTTTTTAAATGTCCTATCTGCCATTTTTAAGTTAAATATTGGTTCCATTTTACCTTTATGATGCAAATTCGATAATTTATTTTAATGTATTGCTAATAAAAAAAATTGTATTGATACAGTTTTTAATGTCATCTACCATTTTCAAGTCATATGTTGGTTACAATTTACCTTATATGTAAATTTGACCGTTTTTTATTGTATTACTAATAAAATAAATAGTGTTGATACAGTTTTTAATGCCATATCTGCTGTTTTTAATTAAATGTTGCTTGCATTTGACCTTTATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12811
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114325 Nonsense 408 761 8 16
Genomic Location (Zv9):
Chromosome 16 (position 2501864)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 1529346
GRCz11 16 1553234
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCTCAAAAACGGTCAGAGTAGTAGGACTGTCCACSGCGCTGGCTAATGCA[C/T]GAGATCTAGCCGACTGGCTGGGCATCGGACAGGTTAGAAAGACCACTGCG
Long Flanking Sequence:
GGTCCCATTTTACCTTTAAAATTTAAAATTTGACTATTTTCGGTGAAATAAATAGTATTGATGGTTTTTAAATGTCATATCTGCCATTTTTAAGTCTAATATTGATTTGATTTTAAATATATTGCTAATAAAAGAAATAATGTTGATGCAGTTTTTAAATGTAATATCTGCCTTTTTTAAATCAAATATTGGGGCAAAATTTTTGCCATTTTTGATGTATTGTCAATAAAATAAATAGCACTGATAGCTTTTAAATGTCATATCTGGCCTTTTTAAGTCTAATATTGATTCCATTTTACCTTTGTGATGCAAATTTGACCATTTTTGATGTATTGCTGTCAAAGAAATGGTATTGCTACAGTATTTACTTTTTGTTTGGCTTCACAGGTGAAGACCGAGGGCCGGTTCTTGAAGTCATTGTGTCCAGAACCAACTTTATTTCATCGCACACCTCAAAAACGGTCAGAGTAGTAGGACTGTCCACCGCGCTGGCTAATGCA[C/T]GAGATCTAGCCGACTGGCTGGGCATCGGACAGGTTAGAAAGACCACTGCGATATACAACCTGCAATATTTTACAATTGAACATGTTTTTGATCAAACAAATGTTTTTCTTTATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGAGGGCCGGTTCTTGAAGTCATTGTGTCCAGAACCAACTTTATTTCATCGCACACCTCAAAAACGGTCAGAGTAGTAGGACTGTCCACCGCGCTGGCTAATGCACGAGATCTAGCCGACTGGCTGGGCATCGGACAGGTTAGAAAGTCCACTGCGATATACAACCTGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3946
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114325 Nonsense 502 761 10 16
Genomic Location (Zv9):
Chromosome 16 (position 2505200)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 1526010
GRCz11 16 1549898
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACCTCATTGCCTTCCTGGCYACTGAAGAYGACCCCAAACAGTGGCTCCAC[C/T]AGGACGAGAGAGAGGTCAGATACAGTATCATCCTCAACTCCCTCATTACNT
Long Flanking Sequence:
ATTAATTTTATTATTTACATCTGTGTTTTATTTGTATTATTTATTTTATTTGATTATTTATATTGTTTTTAATATTTTTATTTTTGTATTTTATTTATTTTTTATTTTTAATATTTATTTATTTTATTTTATTATTTGTTTTATTATTTATTCATTTAATTTAATTTTTATAATTTAATTAAGTATTTATCTATTTTATTTTTATTATTTACTTATTTTATTTTTATAAAATTTTATTTATTTGTTTATTTATTTATTTATTTATTTATTTACTTACTTACTTACTTACTTACTTACTTACTTACTTACTTACTTACTTACTTACTTATTTACTTATTTAATTTTTCACTCTCTGTTTCTTCTGTCCTGCAGCAATCCGTACCCATTCTCCTGCCAAACCCGTCCTGATATTTGTGTCGTCCCGTCGGCAGACGCGGCTCACAGCTCTCGACCTCATTGCCTTCCTGGCTACTGAAGATGACCCCAAACAGTGGCTCCAC[C/T]AGGACGAGAGAGAGGTCAGATACAGTATCATCCTCAACTCCCTCATTACTTTTTGTCCAAAATAATGCTTCAGCACATGCATTTCTCTCACAATATCCCAATAACTTTTTCCCAAAGAGAATGCCTTTTGCTTTTCTCTTTCCATCCAAAAAGATTAATAATAATAGTAATAATAATTGTAATAATAATTAAACACCTAATCAAACACTCCAGAATCAACTCATCAGAATGTTAGAAGAGACTCCAAAACCTGAAGTTAATGGGTCAGATAAGGGAGACATCAGAAATATGTATTGTTGGTGTGCCTCCAGGAACATGGTTGGGAAACACTGGCCTTAATGGGTTCAAAAATGGTAAAGCTCAATTGTTTAACTGTAGGAGAGACGTAAATGAGAATATTTTTGTTCCTTTAAAGATCATGCTTGTAATTTTTAACATCAGTACGTTCCATTGTGAGTTTCTCCTGTGTGTTTTATTCCTCTTCTCTTGCTGAAGAAGCT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28565
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114325 Nonsense 609 761 13 16
Genomic Location (Zv9):
Chromosome 16 (position 2515585)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 1515625
GRCz11 16 1539513
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGATGTTCTCCAGATGATGGGGCGGGCAGGGCGGCCGCAGTTCGATGAC[C/T]AGGGCAAGGCTGTTATCCTTGTGCACGACATCAAGAAGGACTTTTATAAG
Long Flanking Sequence:
TGTGAGAGAATGTTTGTGTGTGTGTGTGTGATTATAGTAGTTGGGTTGCAGCTGGATGGGCATCCGCTGTGTAAAACATATGCAGGAATAGTTGGCGGTTCATTCCGCTGTGGTGACCCCTTATAAATAAAGGGACAAAGCCGAAGGAAAATGAATGAACGAATGAACATGTAACATAATTTCAAATGTTAATAATAATATCACATTCAGGACAAACCAGATTCCTCACAGCAGCTCACTTCACGTCCTCTGTTTGCTCAGTATAGTGTTATTAGCCCTCCTGAATGTTTGATGGAGAGAAGATTTTGTTCAGCACATTCCTGAACATAACAGTTGTAATAACTCATTTCTCAAAGCTGATTTCTTTCCTCTTTGCTACGATGACAGCACATAATATTTGACAAGACATTGTTCACTAGTGTTCAGCTTAAAGTGAGATCTTCTCCATTCCAGATGTTCTCCAGATGATGGGGCGGGCAGGGCGGCCGCAGTTCGATGAC[C/T]AGGGCAAGGCTGTTATCCTTGTGCACGACATCAAGAAGGACTTTTATAAGAAGTTCCTGTACGAGCCGTTCCCTGTGGAGTCTAGGTGTGTACAGAGCCATAAATCTCCCGGTCTGTCCTTTGTGTTAATGGAGCAATTGCATCGTTTTGCATGTGACATTTGCAGTGAAAACTCAAAACATAAATGAACAGAGTACATGTTAACATTATATTAAAACATCAGTTCATATTTTACAACACTACTAAATACAGAGTTCTGGGGTCAGTAAAGTATCAATCTGTAAACATTTGTTTACATATTAAATGAGGAAAATAAGCATGCGTTATGATGTGACTGAAAAAGTGTCTGAAAAGAGCTTTAAAGAATTATTAAGGAAATGGACGTCTGTGTTTTGAGCAGAACCTGCATTTAACCAATCAGAGTCTCGTCTCTCATTCCCTTTAAGAGTCAGTTGCGCCTCACCATGGTGTATTTGCTCTTTACATATCGGAGTGTAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7238
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114325 Nonsense 629 761 13 16
Genomic Location (Zv9):
Chromosome 16 (position 2515647)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 1515563
GRCz11 16 1539451
KASP Assay ID:
554-4409.1 (used for ordering genotyping assays)
KASP Sequence:
GTTATCCTTGTGCACGACATCAAGAAGGACTTTTATAAGAAGTTCCTGTA[C/G]GAGCCGTTCCCTGTGGAGTCTAGGTGTGTACAGAGCCATAAATCTCCCGG
Long Flanking Sequence:
TCCGCTGTGTAAAACATATGCAGGAATAGTTGGCGGTTCATTCCGCTGTGGTGACCCCTTATAAATAAAGGGACAAAGCCGAAGGAAAATGAATGAACGAATGAACATGTAACATAATTTCAAATGTTAATAATAATATCACATTCAGGACAAACCAGATTCCTCACAGCAGCTCACTTCACGTCCTCTGTTTGCTCAGTATAGTGTTATTAGCCCTCCTGAATGTTTGATGGAGAGAAGATTTTGTTCAGCACATTCCTGAACATAACAGTTGTAATAACTCATTTCTCAAAGCTGATTTCTTTCCTCTTTGCTACGATGACAGCACATAATATTTGACAAGACATTGTTCACTAGTGTTCAGCTTAAAGTGAGATCTTCTCCATTCCAGATGTTCTCCAGATGATGGGGCGGGCAGGGCGGCCGCAGTTCGATGACCAGGGCAAGGCTGTTATCCTTGTGCACGACATCAAGAAGGACTTTTATAAGAAGTTCCTGTA[C/G]GAGCCGTTCCCTGTGGAGTCTAGGTGTGTACAGAGCCATAAATCTCCCGGTCTGTCCTTTGTGTTAATGGAGCAATTGCATCGTTTTGCATGTGACATTTGCAGTGAAAACTCAAAACATAAATGAACAGAGTACATGTTAACATTATATTAAAACATCAGTTCATATTTTACAACACTACTAAATACAGAGTTCTGGGGTCAGTAAAGTATCAATCTGTAAACATTTGTTTACATATTAAATGAGGAAAATAAGCATGCGTTATGATGTGACTGAAAAAGTGTCTGAAAAGAGCTTTAAAGAATTATTAAGGAAATGGACGTCTGTGTTTTGAGCAGAACCTGCATTTAACCAATCAGAGTCTCGTCTCTCATTCCCTTTAAGAGTCAGTTGCGCCTCACCATGGTGTATTTGCTCTTTACATATCGGAGTGTAAAAACTGAACGCTTCAGTAGCGAGAAAACAGTTAAACAGATCATCTGCAGCACGAGGATAAAGAA
Associated Phenotype:
Not determined