Busch Lab

ZMP

arhgef19

Ensembl ID:
ENSDARG00000078853
ZFIN ID:
ZDB-GENE-090313-243
Human Orthologue:
ARHGEF19
Human Description:
Rho guanine nucleotide exchange factor (GEF) 19 [Source:HGNC Symbol;Acc:26604]
Mouse Orthologue:
Arhgef19
Mouse Description:
Rho guanine nucleotide exchange factor (GEF) 19 Gene [Source:MGI Symbol;Acc:MGI:1925912]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa29923 Nonsense Mutation detected in F1 DNA Not yet available
sa45800 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa9879 Essential Splice Site Available for shipment Available now
sa9613 Essential Splice Site Available for shipment Available now
sa24325 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa29923
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113598 Nonsense 59 958 1 15
ENSDART00000133269 None None 499 None 11
Genomic Location (Zv9):
Chromosome 23 (position 24435353)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 24221919
GRCz11 23 24148470
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTCGGGAAGGAAGGCCTCTCCTGCGGCAGCACCAACACATTGCTGTGTG[T/A]CAGCAAGAGACATTGGCCTTCATTGACCTTCAAGAGCAAAGTGTTAATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45800
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113598 Essential Splice Site 428 958 4 15
ENSDART00000133269 None None 499 None 11
Genomic Location (Zv9):
Chromosome 23 (position 24433665)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 24220231
GRCz11 23 24146782
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCAGTAATTAGAATATGATGTGTTAAAATGTATTCTACGGTTTCTTCTC[A/T]GAATGAGAAAAGTTTCTGTTGATGAGGATGGAGGCAGCCCTCCCAGTAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9879
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113598 Essential Splice Site 535 958 6 15
ENSDART00000133269 Essential Splice Site 76 499 2 11
ENSDART00000113598 Essential Splice Site 535 958 6 15
ENSDART00000133269 Essential Splice Site 76 499 2 11
Genomic Location (Zv9):
Chromosome 23 (position 24433157)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 24219723
GRCz11 23 24146274
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAACCAGCACATTTTGCTAAAAAGTTACATCTTGACTTTTTTTCCCNTTTC[A/G]GGCAAAGTTTGAGTTGRTGACATCAGAGGCCTCATACATACGGAGCTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9613
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113598 Essential Splice Site 535 958 6 15
ENSDART00000133269 Essential Splice Site 76 499 2 11
ENSDART00000113598 Essential Splice Site 535 958 6 15
ENSDART00000133269 Essential Splice Site 76 499 2 11
Genomic Location (Zv9):
Chromosome 23 (position 24433157)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 24219723
GRCz11 23 24146274
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAACCAGCACATTTTGCTAAAAAGTTACATCTTGACTTTTTTTCCCNTTTC[A/G]GGCAAAGTTTGAGTTGRTGACATCAGAGGCCTCATACATACGGAGCTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24325
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113598 Essential Splice Site 682 958 8 15
ENSDART00000133269 Essential Splice Site 223 499 4 11
Genomic Location (Zv9):
Chromosome 23 (position 24432473)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 24219039
GRCz11 23 24145590
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTCATTCTTCCTTTTCAAAGAATCACACGCCTCAAAATGCTAGTGGAGG[T/C]ATTTCATCATGCATGTCCAATGCGATAGTGACAGTTATCTGTATCCCTTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5047
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113598 Essential Splice Site 907 958 14 15
ENSDART00000133269 Essential Splice Site 448 499 10 11
Genomic Location (Zv9):
Chromosome 23 (position 24427200)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 24213766
GRCz11 23 24140317
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACGCTGGAGAAGGCAGACATCCTTCAAGCTGTAACAATTACAAGTGATGG[T/A]GAGGAAAATCATTTCCCTTCTCCTGGCTATTAAACATTATTTCTGCCCAG
Associated Phenotype:
Not determined