Busch Lab

ZMP

B0S6Y4_DANRE

Ensembl ID:
ENSDARG00000078845
Description:
Novel protein similar to human and mouse stereocilin (STRC) [Source:UniProtKB/TrEMBL;Acc:B0S6Y4]
Human Orthologue:
STRC
Human Description:
stereocilin [Source:HGNC Symbol;Acc:16035]
Mouse Orthologue:
Strc
Mouse Description:
stereocilin Gene [Source:MGI Symbol;Acc:MGI:2153816]

Alleles

There are 12 alleles of this gene:

Allele Name Consequence Status Availability
sa12839 Nonsense Available for shipment Available now
sa40846 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa6074 Nonsense Mutation detected in F1 DNA Not yet available
sa26902 Nonsense Mutation detected in F1 DNA Not yet available
sa2375 Essential Splice Site F2 line generated Not yet available
sa38595 Nonsense Mutation detected in F1 DNA Not yet available
sa14630 Essential Splice Site Available for shipment Available now
sa20874 Nonsense Available for shipment Available now
sa12801 Essential Splice Site Available for shipment Available now
sa40847 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa12839
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110410 Nonsense 19 1679 1 31
ENSDART00000111423 None None 1622 None 34
Genomic Location (Zv9):
Chromosome 7 (position 14800199)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 13681212
GRCz11 7 13925074
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAYTGACAGGAACAGACTCTCAGGATTTCTGTACAACATCTCCATGTACT[T/A]ACAGGAGATGAGCGCCGAGTTAGATGATGGCCAGGGTTTTAGTGACRACC
Long Flanking Sequence:
GCCTCTTTAGCATTTCCAAAACGCTCCATTTTCGGGGCTCGAAAACTCTGGGGTAGTGTGGATGGAAGCTGTTCCTGTAACAAATCTTTAAATCTAAAATGTATTAGTGTAAATGGGGCCTAAGTTTACCCAACTATGACGATGTCTGAGAAACTCAGAAATGTAAAAAAGGGTGCATACAGGCTGTTTGTGTGCCATTCCCTGCTATGACAACTAAATTAGTTTGTTTGTCTGTACAGGAAGCAAAAAAGAAGACCAAAGGGAGGCTATATTAAAAGAGCTTGTCGAGATTTGGAGGAAAGGTGGAGGATGGAACCCATACCGAGTACAGCCGCCAGCAGAAAGACGAAAAGATCAACAAATCCAATCCATCGTGAAGGGCATCATGGGAGGCCTCAAATCCCTCGGAGTCCTGCCGAAGAAAAAAAGCATCCCATCTATAAACAAATCCATTGACAGGAACAGACTCTCAGGATTTCTGTACAACATCTCCATGTACT[T/A]ACAGGAGATGAGCGCCGAGTTAGATGATGGCCAGGGTTTTAGTGACGACCAGTTTTGGGAGAACCTTCTCTATTCTCTCCTCCAGACCGGAAGGGAAGCCTCGCTTGGCATGTGGGATGGGAAAAGTCCCCCGCGACCCACTTTTAGGCTTCAGGATCTGTTCCTGTCTCTTAGGGGAAGCCCACATTGGGATGGACTTCTAGGTTTGGTGCAAAGCCTTTTAACCCTCTCCGAAAAGCAGCCCCAGAAGCCCATTTTAACTTTTATTTCGCAGAATTGGAAAACCATCAGTGCTTTGCTGGAAACGGTCCTCCAGGCGGTGGTCAGCGGGACGTACGGACAAGCTGTCGCAGGTCTCCAGGGTTTCATATGCGTCTTGAAAGGACGGAATGATTGCTCTTTTAACCTGAGCTGGCTTGAGCAGCTTATAAGCTTCATGGAGACCAGAAACTGGAAACCTGTGGTCAGTCTTCATCCTGTGAATGTGGAGAGCCATCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40846
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110410 Essential Splice Site 236 1679 4 31
ENSDART00000111423 Essential Splice Site 205 1622 3 34
Genomic Location (Zv9):
Chromosome 7 (position 14804567)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 13685580
GRCz11 7 13929441
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTCACTTTTGTTTCTTTGTGAAGGCGACCTCAGGCAGTTAATATTATGG[T/A]AAGTGTCATTCTAATGCATTTCTGAGTGTATAATAATAATGAAGACTATC
Long Flanking Sequence:
TTAGCTGATGATTGATTATAAAGCTTGTTTGGCATGCTGTCCCCGGGAGAGAACCCTGAGCTCATAAGATCCTCGAGCCCAGGGTTCCCACCCGTTTGTAGGGCAAGAGTTGAGAATATACATATACTGATTTAATTCATCTCTAATTAAATTTTATTTTGAAATACACTCTCAGCTCCATTCTGAACTCTGCACAACTCTGTCTGAAATCACAATGGCATTGCTAGTCATTAACCGGATCTTTGTTAATCCTATAGCCTGGATAATCTCCTCTTTCTTTTATGTCTGTAACCGTACACCTGCGGCATTATGTGCTCAGCTATGCTGTTACATCAAGGCCAATTGTATAATACAGCGTGCCGGCTCTCCATTTTCCTCAATTAATCATCAGCACTAAGCCTTCATCATCTGTGATTTGTACCAGTCAACTATTCACCCAGAACCTTTTCCATTCACTTTTGTTTCTTTGTGAAGGCGACCTCAGGCAGTTAATATTATGG[T/A]AAGTGTCATTCTAATGCATTTCTGAGTGTATAATAATAATGAAGACTATCATGAATTAAACAAATATGCTGTCCTCTTTGTACAGGGGAATTAGACATAACTTGACTTGGAACGCTCAAGCGATGGGTTTCAGGTCAGATGGTTTACCCAGCAGGCCGTCTTTCATGACTTGTCCATCTTCAGAAGAGGAAACAAGGACTTTAAAACCTCAACCATCATCTAGAACTAAACTTCGCCAGTCCCACATGAACATTCAGGAGCAGACTGATGGAAACCCCTTGATCTCTGCTGAGATTCTGGAAGCTGCCTGTAACGCCTCTATCCCTGGTCTCACCGGGGTCTCGAATTTTACCGTCTTCCTCTACTGTAATCTTTTTGATGACGAGAATGGCTCACAGGACCCTCAAGTCAACCATTTAGGCGTTGACCTGCATGCAACCTGCTCAGATGCTGCGTGGTACCTTTCAGCAGCAGAGGAAGATTTCCTTTGGGTTCACGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6074
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110410 Nonsense 301 1679 5 31
ENSDART00000111423 Nonsense 270 1622 4 34
Genomic Location (Zv9):
Chromosome 7 (position 14804847)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 13685860
GRCz11 7 13929721
KASP Assay ID:
554-3747.1 (used for ordering genotyping assays)
KASP Sequence:
ACTTCGCCAGTCCCACATGAACATTCAGGAGCAGACTGATGGAAACCCCT[T/A]SATYTCTGCTGAGATTCTGGAAGCTGCCTGTAACGCCTCKATCCCTGGTC
Long Flanking Sequence:
TATGTCTGTAACCGTACACCTGCGGCATTATGTGCTCAGCTATGCTGTTACATCAAGGCCAATTGTATAATACAGCGTGCCGGCTCTCCATTTTCCTCAATTAATCATCAGCACTAAGCCTTCATCATCTGTGATTTGTACCAGTCAACTATTCACCCAGAACCTTTTCCATTCACTTTTGTTTCTTTGTGAAGGCGACCTCAGGCAGTTAATATTATGGTAAGTGTCATTCTAATGCATTTCTGAGTGTATAATAATAATGAAGACTATCATGAATTAAACAAATATGCTGTCCTCTTTGTACAGGGGAATTAGACATAACTTGACTTGGAACGCTCAAGCGATGGGTTTCAGGTCAGATGGTTTACCCAGCAGGCCGTCTTTCATGACTTGTCCATCTTCAGAAGAGGAAACAAGGACTTTAAAACCTCAACCATCATCTAGAACTAAACTTCGCCAGTCCCACATGAACATTCAGGAGCAGACTGATGGAAACCCCT[T/A]GATCTCTGCTGAGATTCTGGAAGCTGCCTGTAACGCCTCTATCCCTGGTCTCACCGGGGTCTCGAATTTTACCGTCTTCCTCTACTGTAATCTTTTTGATGACGAGAATGGCTCACAGGACCCTCAAGTCAACCATTTAGGCGTTGACCTGCATGCAACCTGCTCAGATGCTGCGTGGTACCTTTCAGCAGCAGAGGAAGATTTCCTTTGGGTTCACGTTTGCAGTGAATTCTTCGCTCACGAGTTCAACAAAACAGTGTGTGCCAACTCTACATTCTGGCTGCAGCACGCACAACAGGTACATCCAGCTACTTTTAGTTTTCGTTTTCATGAATGATCAGCCATAAATACAAAATTCTGTCGTCATTTACACACCCTTGTGTTAATCTGAACCCTTACATTAAAAAAAAAACACATTTTGATAGATCTTTAAATGAAAATAAATATTCTGTCATAAGCATTCTGTTAAATTCTGTCGTCATTTACAAACCCTTGTGTAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa1851
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110410 Nonsense 399 1679 5 31
ENSDART00000111423 Nonsense 355 1622 5 34
Genomic Location (Zv9):
Chromosome 7 (position 14805140)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 13686153
GRCz11 7 13930014
KASP Assay ID:
554-1842.1 (used for ordering genotyping assays)
KASP Sequence:
AGTTCAACAAAACAGTGTGTGCCAACTCTACATTCTGGCTGCAGCAYGCA[C/T]AACAGGTACATCCAGCTACWTTTAGTTTTCGTTTTCAWGAATGATCAGCC
Long Flanking Sequence:
CCTCTTTGTACAGGGGAATTAGACATAACTTGACTTGGAACGCTCAAGCGATGGGTTTCAGGTCAGATGGTTTACCCAGCAGGCCGTCTTTCATGACTTGTCCATCTTCAGAAGAGGAAACAAGGACTTTAAAACCTCAACCATCATCTAGAACTAAACTTCGCCAGTCCCACATGAACATTCAGGAGCAGACTGATGGAAACCCCTTGATCTCTGCTGAGATTCTGGAAGCTGCCTGTAACGCCTCTATCCCTGGTCTCACCGGGGTCTCGAATTTTACCGTCTTCCTCTACTGTAATCTTTTTGATGACGAGAATGGCTCACAGGACCCTCAAGTCAACCATTTAGGCGTTGACCTGCATGCAACCTGCTCAGATGCTGCGTGGTACCTTTCAGCAGCAGAGGAAGATTTCCTTTGGGTTCACGTTTGCAGTGAATTCTTCGCTCACGAGTTCAACAAAACAGTGTGTGCCAACTCTACATTCTGGCTGCAGCACGCA[C/T]AACAGGTACATCCAGCTACTTTTAGTTTTCGTTTTCATGAATGATCAGCCATAAATACAAAATTCTGTCGTCATTTACACACCCTTGTGTTAATCTGAACCCTTACATTAAAAAAAAAACACATTTTGATAGATCTTTAAATGAAAATAAATATTCTGTCATAAGCATTCTGTTAAATTCTGTCGTCATTTACAAACCCTTGTGTAAATCTGAACCCTACGTTTTTTTTTGTAACTAATTTTGATAGATTTTTAAATGAAATTTGAGAGATCTCTTCATTAAAAATCCTGGTTAGTTTAGTTTATTTATTTATAAAGCGCAATAAAACAGTTGTTGACCATTGTGCTGTACAAACCTAAAAGCAAATTATCAAAAATAGACAGCAACAGATAAAACAACATAGAATACATCCAGCATACCACACAGAATCAACGATAAATAACAAGACACCAGATACAGTAGGTACACTGTAAAAAGTGATTAGTTACTTAAAGCAAGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26902
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110410 Nonsense 480 1679 7 31
ENSDART00000111423 Nonsense 434 1622 9 34
Genomic Location (Zv9):
Chromosome 7 (position 14807805)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 13688818
GRCz11 7 13932678
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGGCTGCGGAGTATTGCTCCAAAGTCACAATCAATCACAAGCCGTCAAAA[C/T]AAAACTGCGACTATTCAAAGTGGAAGCTGGAATATTTCACAAACTCCACC
Long Flanking Sequence:
TCCTGCAGATTTTAGCTCCAACCCTAATCAAACACACCTGAACAAGATAATCAAGGTCTTACTAGGTATACTTGAAACATCCAGGCAGGTGTGTTGAAGCAAGTTGGAGCTAAACCCTGTAGGGACACCGGCCCTCCAGGACAGAGATTGGTGACCTCTGCTTTAAAGTGTTCTGTATTACTAATGGCTTTGCTGTGAAATTTCCTCAGGTAGAAGCTACAAGGTATTACCAGTACCTCAACCAGTCAAGTATTGACGACCTCTGTCTTCAGCTCTCCAATGAAGCTTCTGCTAAATCTCCTAAAGACGACACTGAAGATTGCCTAGCATTGCTAAACAGCAAAACACTCACCGCCCAGGACTTTAGAAAATGCTTTCTCCCAAATAACACAGCCCTCATCGCGTCTTTATGCGGAAACGAGTCGTCTCAAATACCCCAAGATGGCAGCTGGGCTGCGGAGTATTGCTCCAAAGTCACAATCAATCACAAGCCGTCAAAA[C/T]AAAACTGCGACTATTCAAAGTGGAAGCTGGAATATTTCACAAACTCCACCGCCCTTGAGCTTTGTAGCAAAGCAGGTCTGAAGGACTATATTTGTAAAAACGCCACGCTTTACCTCACACTACTTCAAAAGCAGCCTTCACTCACAGACGACTGTTTGAACTCTGAGGATAAAATCGGCGCCAAATGTGTCCTCCAGAGGCTGTTTGACATGCTGCCTGCGCCGTATGACTTTGACACTTCTCAACTCTGCGTGAACCCCTTGCCTATCCTGCAAGACGCCATTCATAAGCTTACTTTATGTGAGGGGGTAGTCGATGAACGCACGGGATGGTTGGCGACGGTAAGTTACGTGCTTCGAGTTTTGGATTTTGTGGTCGGGCTTTCGGCTGGATTGGAGGAAGGAGAGCTGGAAGTGCGTCAGGGTTTGGGTCAGGCCATCCTTCTGTCCAGCCTGCAGGACAATGCCTCTTTTTGGGCTACTCTACGACCCAACGCGTCC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3632
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110410 Nonsense 672 1679 7 31
ENSDART00000111423 Nonsense 610 1622 10 34
Genomic Location (Zv9):
Chromosome 7 (position 14808383)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 13689396
GRCz11 7 13933256
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTTCTGAAGAGAGAGCAAAACTCCACCTTAAAAGAAGATCTTTTGAGCTG[C/A]TTCAGTGTATGTCATGCATTTCAATGCTTCCNTGCCACACTGTAAAACATG
Long Flanking Sequence:
CTGAAGGACTATATTTGTAAAAACGCCACGCTTTACCTCACACTACTTCAAAAGCAGCCTTCACTCACAGACGACTGTTTGAACTCTGAGGATAAAATCGGCGCCAAATGTGTCCTCCAGAGGCTGTTTGACATGCTGCCTGCGCCGTATGACTTTGACACTTCTCAACTCTGCGTGAACCCCTTGCCTATCCTGCAAGACGCCATTCATAAGCTTACTTTATGTGAGGGGGTAGTCGATGAACGCACGGGATGGTTGGCGACGGTAAGTTACGTGCTTCGAGTTTTGGATTTTGTGGTCGGGCTTTCGGCTGGATTGGAGGAAGGAGAGCTGGAAGTGCGTCAGGGTTTGGGTCAGGCCATCCTTCTGTCCAGCCTGCAGGACAATGCCTCTTTTTGGGCTACTCTACGACCCAACGCGTCCCTGAGTGTACTTCACACTGTCGGCGTCTTTCTGAAGAGAGAGCAAAACTCCACCTTAAAAGAAGATCTTTTGAGCTG[C/A]TTCAGTGTATGTCATGCATTTCAATGCTTCCTGCCACACTGTAAAACATGCGTAAATAAGCAGTTTTCCATATTTTGTGATTCATGTTTTGAATTTTTCTGTTTATTTAGGCTGGGCTTTTGATTATAGGGATTATGAGATGTGCATTATGAGACCTTGATCTTTCTTCTTTTATTAACATTGACAATATTATCAATTATACATTGACAATGTGGCGGTGGGGTACTGGATTTCATCAGGCACAATGTGGCATTAGCCCCCGCATACAGACCTTTTCAGAAAATTATTTTTTGTAAAGGGATCATGTGTTTTTGAAATTACCGGTAAATTTGTTCCATCAATTTTCTGGAAAGAAAAGTTATAACATTCCCAGTAATTTGCTGGAATGCTGCGCTGATTGAATGCAGAAGGAAAATTAGTCGATGAAGTCTAGTTTGGATATGCGGCCAACCGGAATTGCGATATGCACATTAATGTAGCAGCATTTTTTATTATACTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2375
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110410 None None 1679 None 31
ENSDART00000111423 Essential Splice Site 675 1622 12 34
Genomic Location (Zv9):
Chromosome 7 (position 14812586)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 13693599
GRCz11 7 13937459
KASP Assay ID:
554-3140.1 (used for ordering genotyping assays)
KASP Sequence:
GTCCCATGTTCATCAGAGCTGGGATCAACTTCACGTGGAAACTATACAGG[T/C]AAACAGGACACCTAATTTGTAAAAGTTTTTTCAGCCTGATAATAATCCCA
Long Flanking Sequence:
GAATACTGGTAACAATTGGCTTACTGTTTGTTTTTCATACTATTGAAGTCAATAGCTTCAGGTTTCTAACATTCTTCAGAATACCTTTTTTGTGTGTTCAACACTGAACGTCTGACTGAATGTTCATTTTTGGGTGAACCATCCCTTAAAAAAAAAAATCTATATATATATATATATGAAACAGTTCTTTACATTGTTTTGCACACTCTTTTGCTTCATGCTGCATGACCAAATTTAAAAGCCCTTGAGTTAAGCTCAATATAAACAGAACATATTAACAATATTCATAGCACTTTCCATGTTATAATTAATATGTTATGATAATGATATGATACGTTTGTCAATATCTAATGTCAATATTCATTTGCTTTAGGAGTATCTACAAATGCCCAGAGAGAGCATTCGCAGTGTGGTTCTGTCCGCAGAGAAAGATGCTGTGAAAAGATTTCTGTCCCATGTTCATCAGAGCTGGGATCAACTTCACGTGGAAACTATACAGG[T/C]AAACAGGACACCTAATTTGTAAAAGTTTTTTCAGCCTGATAATAATCCCAAACACACTGCTAATGCAACAAAATCTTATTTGGAGAGAAAAACAGCTGAGGAAACAAAGGCAGTGATGAAATGGCCTCCACAGAGTCCAGACCTGAATATTATATAGGCAATATTATAGGCAGTTTGAGATTTATCTGGGGCAAAAAAAGAAAGCTAGAACATGCTAAGTCCAAGGAAGAACTTCTAGAAAGGCTGAAACATGTTTGATATTATAATGATATACTTGCATATAATTTTAGAAAAGGCTCAACAACAACGTTCAAGCTGTTGCTTGGTTCTAAAGAGGTTAATCACAGACATTTGAGGCTAGTCTTTTGATTTCAAAAATAATTTAGTTCTTAATATTGTGTACGTAGTTCCCATATTTTCTGTTTGTATGTTGAAGGTATAGTTCACCCAAGAGTAATGGCCCTGCACTGGCTTCATACCTTTTAGATAGATAGGTTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38595
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110410 Nonsense 1028 1679 16 31
ENSDART00000111423 Nonsense 971 1622 19 34
Genomic Location (Zv9):
Chromosome 7 (position 14820249)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 13701262
GRCz11 7 13945123
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACGCTCTGCAGATTGAAGCCATTGTTTCCGGGTCTGGACCCTGTTTTCT[T/A]GAAAAACTTACTCGTATCTGAAACTCCACTTGATTGTCATTGTTGGAGTT
Long Flanking Sequence:
CACTTTTCTTAAACCCAAAGCGCTACATAAGAAGATGTTAAACACGTCAAATAATTTTAGCTCTGTTTAAGAAGTCTCTAAATGTCGCTAAATGACGTCATATGTCAATTTGCATATTACTGACGTCATCACGTCCAACTGTTTCTGTTTGTTTAACAGCCTATGGTTAATAAAGGGCTATAAATATTTGCACTACACTTTTTATATGCATGTTGATTTAATTAATTGTATAGTTGTTTGATTCAGTCAAATAAATTCGAAAAGTAACTTAATTTAATTAGTAACTTACTTATAATCTTAGTAATTTACCCAACACTGCTATGCTTTTACACCAGTATTTATTGTCATCTAAACTTATTATCGGTTTATTGAAAATGCATCTTAATCCCAGGTGTAAACACAGCCAGGGTCTTGTATTTACAGTTTCAATCCTGTTTAGTTCAGTGCCAACACGCTCTGCAGATTGAAGCCATTGTTTCCGGGTCTGGACCCTGTTTTCT[T/A]GAAAAACTTACTCGTATCTGAAACTCCACTTGATTGTCATTGTTGGAGTTCCCTGCTGTCTAATCTGCGTCCTGCTCATCGAGCGATGGTCCATTTTGCTCTCCAACAGGTATGTTTTTACAAATCAGTCAGCATTTGTACTCGTGCATTAGATCTGATTTGGAAAATCAAACGGCACACTGTTTGTTTTAAGGCTCTGGAACGCATTTCTGCAAATGTAACCCAGCAGCTGCAATGCCTTGTACCATTCGTCTCCTTGAAGAAAATAATGTCAGATCTAGATGGCGAGGCAGTTCTTCAACATATATCTCTGTTAAAGCATATGCCCTGGTCTCATCAACAGGTACAACCCTAATTTCATACTTTTTCTCTTGGCAAGCTTGCTTTTTTCTTGCTCACACACTGTCACCGGCCACATGTCCATCAAAACGTGCAAATTTATAAAAAATGACATTAATAATTTGGAAATAAAGCTCTAATGTGATTTAGAAATCCAGACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14630
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110410 Essential Splice Site 1203 1679 20 31
ENSDART00000111423 Essential Splice Site 1146 1622 23 34
Genomic Location (Zv9):
Chromosome 7 (position 14832881)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 13713894
GRCz11 7 13958685
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCTGATATTGATCTRAACGACTTGGACCCCTCATTTGCTGCAAGCTTACC[G/A]TGAGATCAATTCTGTGCTACCCACAATCCTTTTGTTTGTTTTGCTCTTCT
Long Flanking Sequence:
TTACTTAAGTATGATTTTTCAGTACTCTTTCCACCACTGCTGTTGAACAATAAAAAAGTTGAATTATAAAAATTAAAAAAATCAAGGCATGATCATATTTTATTTTGGTAAAATAAGCGTAATCTAGAGGCCTTTGCCTTTCATTTAAGCCACTTCTGATGCCAAATGATCAACTAGAAGTCAAGTTATTATTTGTTGCTCCTAAAACTTAAATAGGCGACAAGACTTTTGTCAGGTAGTATAGGTGTGAAGTCTGTCTAATCTATTAGACATCTATTAAACACAAAATTGTTTGGTGGAGAAATAATGTTTCATTATTAAAATGCATGTCTCACCTACTAAAAAATCCCTTTTGGTGTCTCTGCATCAAACATGCAACGACATTTTATGATTCCATCAAATTTTATGTTTCCACAGAGGAAATGCATTGTGTTGGAGTTACAGCAACAGCCTGATATTGATCTGAACGACTTGGACCCCTCATTTGCTGCAAGCTTACC[G/A]TGAGATCAATTCTGTGCTACCCACAATCCTTTTGTTTGTTTTGCTCTTCTTCTTACTTGCAGGGACTTATTGTTGTATTTGGTCTCAAAGGTTGACCATGATGGAGCACCTGTCTAACTCCTCACTCATAGGCGTACTGGAGCATGTTCGACAACACTTCATTGACTTCCTGCAGCTTCCACGACACAAACAAACGGCTCTGGCAGAGAAAGCTATTGACGTACTCGTAAGACTGGAATTATTGCAGATCTTCAACATTTCATCACTGAATCCTTTATGAGCACATTGGATATAAATACAGTGGAAACAGTAGCTTTGTGAAATGTTACTACAATATAAAACTTTTAACAGGGTATAATAGTTGAAACATTTTGGAGTACCATGGTATTTTTAAGCTTGTACCAGACATAGACATATTATTTCTTTTCTGTTTAATATGTTATACATTAAAATGTTTCTATAAAAGCAGCCATTACGTTGCTTTTTAGTGTCACATTCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20874
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110410 Nonsense 1234 1679 21 31
ENSDART00000111423 Nonsense 1177 1622 24 34
Genomic Location (Zv9):
Chromosome 7 (position 14833063)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 13714076
GRCz11 7 13958867
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCGTACTGGAGCATGTTCGACAACACTTCATTGACTTCCTGCAGCTTCCA[C/T]GACACAAACAAACGGCTCTGGCAGAGAAAGCTATTGACGTACTCGTAAGA
Long Flanking Sequence:
AAGTTATTATTTGTTGCTCCTAAAACTTAAATAGGCGACAAGACTTTTGTCAGGTAGTATAGGTGTGAAGTCTGTCTAATCTATTAGACATCTATTAAACACAAAATTGTTTGGTGGAGAAATAATGTTTCATTATTAAAATGCATGTCTCACCTACTAAAAAATCCCTTTTGGTGTCTCTGCATCAAACATGCAACGACATTTTATGATTCCATCAAATTTTATGTTTCCACAGAGGAAATGCATTGTGTTGGAGTTACAGCAACAGCCTGATATTGATCTGAACGACTTGGACCCCTCATTTGCTGCAAGCTTACCGTGAGATCAATTCTGTGCTACCCACAATCCTTTTGTTTGTTTTGCTCTTCTTCTTACTTGCAGGGACTTATTGTTGTATTTGGTCTCAAAGGTTGACCATGATGGAGCACCTGTCTAACTCCTCACTCATAGGCGTACTGGAGCATGTTCGACAACACTTCATTGACTTCCTGCAGCTTCCA[C/T]GACACAAACAAACGGCTCTGGCAGAGAAAGCTATTGACGTACTCGTAAGACTGGAATTATTGCAGATCTTCAACATTTCATCACTGAATCCTTTATGAGCACATTGGATATAAATACAGTGGAAACAGTAGCTTTGTGAAATGTTACTACAATATAAAACTTTTAACAGGGTATAATAGTTGAAACATTTTGGAGTACCATGGTATTTTTAAGCTTGTACCAGACATAGACATATTATTTCTTTTCTGTTTAATATGTTATACATTAAAATGTTTCTATAAAAGCAGCCATTACGTTGCTTTTTAGTGTCACATTCACAAAACTTACTGATTTTATGTTAAGGTAAACATTTCACAACATACTAAAAATATTAGGTTGAGTTGCTTAATATTGTTTTTGTGGAAACTGCTTTAAAAAATGTTGAAATAACAGCAAATATTTTGTAAAAAACACATGTTTGCTCTCAGTTCAACTTGATGATCAAAAGCATGTCACAAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12801
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110410 Essential Splice Site 1390 1679 24 31
ENSDART00000111423 Essential Splice Site 1333 1622 27 34
Genomic Location (Zv9):
Chromosome 7 (position 14838540)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 13719553
GRCz11 7 13964344
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAAGGGATTACGAGAAAAGAKGAACGTCCTCATCCACAGGATCATTAAAG[G/T]TCGATGGTGGATGAGACRSGGTGAGTCGTGTTCTGTGTTCATTCACAGAA
Long Flanking Sequence:
ATTGTTTGTTTAACACTCATACTGCCATTTCTGACAGTCCAAACTCACAGATTTAAAAATGCTTTGTGCTAAGCATGACCCATCTTGTGCTATCCTGTTTTTTGGATTGTTTAAATGTCGTTACACTATATGTTGCATTCATATCTCAGTTAAGTTCATTTAGACATCTTTTTAGTTGTTTTGGACCGCTCATTTGGTACACTCCAGGTTTTGGATGGCAGCGTTTATACGTATTCATACAACCTACACTAATAAAGCCATCGCACAAAAGTTTGTTTTAGTCAAACCTGCCAAGTGTGAACACAACCTAACACCAAAGGCTCAGTATATCATCACGTTAAACCTACATTTTCCCTTCAAGGGTGATTTAGGTAAAGACACGGTTGAGCAGGTTCTGATGAGCCAGTGGATTTGGAAAAACAGCGAACTGGGAGAAGCTTGCTGGGACTTAAAGGGATTACGAGAAAAGATGAACGTCCTCATCCACAGGATCATTAAAG[G/T]TCGATGGTGGATGAGACGCGGTGAGTCGTGTTCTGTGTTCATTCACAGAATCCCTCAGATGTTCCCTTTAGAGAGGTACTGTAAACCAGTGGTTCTCATTTCTGGTCATTGCGACCCCTCGCTCTGCTCCCTTTAAGGCAAGTCATTTCACTCGATAGCCATCTTTGAAACATCTCTCGGTCTCAAACACAACATTGTGTTTGAATGGGGAAACATCAAATTCTCCAAAATTTCTTGCTAAGCTAATGATTAAATATCATATTAGAATCACCAATACAATTAAAAACAACTTTAGTTTAATTTTTAAACATTCGAATCACACAAAATCTGCAGAAACTCACGTCTGGTCTGATCCTCTCCTGCAGAGAATCGTCAGACTATAACAATCGATGATTGGCTGCTGTTGTTCATTCGCCATATTGACCGTTACTATTTTTCCTATTCAAAAGTATACAAGTGACATGTCTTGTGTATTCTATAGTCTTTGACATTATGCATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40847
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110410 Nonsense 1466 1679 27 31
ENSDART00000111423 Nonsense 1409 1622 30 34
Genomic Location (Zv9):
Chromosome 7 (position 14843180)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 13724193
GRCz11 7 13968985
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACAATCATTCTCTTAGGTGTATAAACCAGTGAAGCAGCTTAAACCAGAA[C/T]AGGTGTTGGAACTGGGTTGTATAGTGACTGAAATGGGCGAAAGAGAGCTA
Long Flanking Sequence:
TCAAGAGGCTATCCCATTCAATAAATTCAATTCAATACACGCTTCTTTCGAAATGTAATCATGACAGAATATCCTGTAATGTCTACTTTGCAGGGCACTTGCAGTTAAATGGAACAAACTTCTACAGTATTGAGATTAACATACAGAGCAGAGCGGGGGGGTCGTGAGGACCAGGCTTGAGAACCGCTGCCGTAAACCATATATTGTTTCTTTACTAGGGCCCATCCCAAGCTGTGCAGACATTAAAGGGACATTTCCCTCGGCCTGGAGGTCCTATCAGCTAAAACGAATGAAGAGGAGAGAGCTGAAGACTTGTGTTGAGTTCATCGGCCAGGATGACACACTTGACGACGAGCAACGTGAAGCACTTTGGATGGAACTCAGACCAGTTAAGACATTTGTACACCAAATGCTGTTCAGTGATTATGAAATGAACTTAAAATCTCACACAACAATCATTCTCTTAGGTGTATAAACCAGTGAAGCAGCTTAAACCAGAA[C/T]AGGTGTTGGAACTGGGTTGTATAGTGACTGAAATGGGCGAAAGAGAGCTACAAGCTGTCAATCTGTCCAGTTTGGGTGTAGTAGCCCATCTTGGGGACCTCAATGGGTGGAACGCTAAGAAAGTATGTGTTTTTATTCTATTTTTTAAAGATTGACTTGAATTTAATTCGAAACTTAAAGGGATTGTTCACCCAATAATGAACATTTTGCTCACTATTTACTCACCCTCAAGGGGTTCCAAACCTTTACAGGTTTTAATATTCTATTCAAAAATAAAAAAGCTATGCTGAGGAAAGCTGAAAAGTACGAAATAATTAAGATAAACTAATACTATGGAAGTTAATGGTTATAGGTTTCAAGCTTTCTTTAACATACAGTATCTTCTTTCAGGATGTTTGTGGAATCTTAAAATGTTTTAAATTTCGAAAACTAAATTTTAGGCCTTACAAAGTATTAAAGTCTCTGAAATATTGTATTGTCCTTCTTAACCTTTGTAACCC
Associated Phenotype:
Not determined