Busch Lab

ZMP

TNS1 (2 of 2)

Ensembl ID:
ENSDARG00000078842
Description:
tensin 1 [Source:HGNC Symbol;Acc:11973]
Human Orthologue:
TNS1
Human Description:
tensin 1 [Source:HGNC Symbol;Acc:11973]
Mouse Orthologue:
Tns1
Mouse Description:
tensin 1 Gene [Source:MGI Symbol;Acc:MGI:104552]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa20690 Essential Splice Site Available for shipment Available now
sa40676 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa33860 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa20690
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115118 Essential Splice Site 254 1678 10 33
Genomic Location (Zv9):
Chromosome 6 (position 22498658)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 18754104
GRCz11 6 20814326
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAAGAAATGATAATGTATTTGGCAAAGTGTGTTTTGTGTTCATATTCAC[A/T]GTGCTGACCAGGCATTGGACAGGTTTGCGATGAAGCGTTTTTATGAAGAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2307
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115118 Nonsense 716 1678 17 33
Genomic Location (Zv9):
Chromosome 6 (position 22473733)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 18729179
GRCz11 6 20789401
KASP Assay ID:
554-2964.1 (used for ordering genotyping assays)
KASP Sequence:
CTCATGGACTGATAGACTACAGTGGGCAGAATGAAGGAATGTATCGCTCA[C/T]AGTCATATGGTGGCATGATGCTGGATGGAGGWCATAGGTATTTGCCACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40676
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115118 Essential Splice Site 1094 1678 20 33
Genomic Location (Zv9):
Chromosome 6 (position 22468488)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 18723934
GRCz11 6 20784156
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTGAGGAGATGGAATCAGCTCCTTTTAGTTCTGCCCACGACAATGCTGG[T/C]GAGACACATCTCCTGACACCTGCCATTCCTGTTTCTGTAAGATTTTGCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33860
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115118 Essential Splice Site 1632 1678 33 33
Genomic Location (Zv9):
Chromosome 6 (position 22452780)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 18708226
GRCz11 6 20768448
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGGCTGAAAAAAACTGACTCTGATCAATCTTTTTTCTGGTTCACAATGC[A/T]GGCTTTTTGGGTTTGTGGCTCGAAAACAAGGAAGCACGACTGATAATGTG
Associated Phenotype:
Not determined