Busch Lab

ZMP

ccdc149a

Ensembl ID:
ENSDARG00000078829
ZFIN ID:
ZDB-GENE-041010-113
Description:
Coiled-coil domain-containing protein 149-A [Source:UniProtKB/Swiss-Prot;Acc:Q5XJA2]
Human Orthologue:
CCDC149
Human Description:
coiled-coil domain containing 149 [Source:HGNC Symbol;Acc:25405]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa25378 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa34244 Nonsense Mutation detected in F1 DNA Not yet available
sa7109 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa25378
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112841 Essential Splice Site 269 463 8 12
ENSDART00000124031 Essential Splice Site 218 352 7 10
Genomic Location (Zv9):
Chromosome 7 (position 73944580)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 71133465
GRCz11 7 71374365
KASP Assay ID:
554-7380.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGCAAGTCCAGTAGCAGATCTCTCACTGGTGTCCTTTCTCCTAAACAAG[G/A]TGCTCAAAAGAAGTGTACTAACAGGAATTGGTTGAAATGTTGTTATTTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34244
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112841 Nonsense 431 463 12 12
ENSDART00000124031 Nonsense 351 352 10 10
Genomic Location (Zv9):
Chromosome 7 (position 73961220)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 71116825
GRCz11 7 71357725
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACCTGTCACCCGTGAGGAGAGCGACCCAAGCGGGACACGCACTAATGGA[C/T]AGGTCAGAGCACTTCAGACAACACACTCATATTCACTGAAAGGGGAAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7109
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112841 Nonsense 441 463 12 12
ENSDART00000124031 None None 352 None 10
Genomic Location (Zv9):
Chromosome 7 (position 73961252)
KASP Assay ID:
554-5226.1 (used for ordering genotyping assays)
KASP Sequence:
GGGACACGCACTAATGGACAGGTCAGAGCACTTCAGACNAACACACTCATA[T/G]TCACTGAAAGGGGAAGAGAAGCTGATTTGTGACTTGTGTGATGTTGATCC
Associated Phenotype:
Not determined