Busch Lab

ZMP

si:dkeyp-1a11.3

Ensembl ID:
ENSDARG00000078822
ZFIN ID:
ZDB-GENE-070912-641
Description:
Novel protein similar to vertebrate coiled-coil domain containing 18 (CCDC18) [Source:UniProtKB/TrEM
Human Orthologue:
CCDC18
Human Description:
coiled-coil domain containing 18 [Source:HGNC Symbol;Acc:30370]
Mouse Orthologue:
Ccdc18
Mouse Description:
coiled-coil domain containing 18 Gene [Source:MGI Symbol;Acc:MGI:1922974]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa39777 Nonsense Mutation detected in F1 DNA Not yet available
sa25099 Nonsense Mutation detected in F1 DNA Not yet available
sa39776 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa39775 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa691 Nonsense Available for shipment Available now
sa39774 Nonsense Mutation detected in F1 DNA Not yet available
sa14616 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa39777
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112829 Nonsense 73 1321 2 27
ENSDART00000132167 Nonsense 73 779 3 18
Genomic Location (Zv9):
Chromosome 2 (position 10354062)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 10779158
GRCz11 2 10562757
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTTAGAGGACCTTCAGAATCCTGATCCTGTAGATTCACACCCTGAGCAA[C/T]AAGCTTGTGCACATATCTTTGACTGCAGGGTAAGACACTTAAGAGACAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25099
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112829 Nonsense 168 1321 4 27
ENSDART00000132167 Nonsense 168 779 5 18
Genomic Location (Zv9):
Chromosome 2 (position 10351830)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 10776926
GRCz11 2 10560525
KASP Assay ID:
554-7297.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGAGCAGATTCTGGGTCTAGAGGCTGAGCTGGACACCCTGACCAAGGCTT[T/A]AGAGTAGGTGCATCTTCTCTACCACTCACTCGAAAAAGCATGTTGGGTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39776
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112829 Essential Splice Site 169 1321 4 27
ENSDART00000132167 Essential Splice Site 169 779 5 18
Genomic Location (Zv9):
Chromosome 2 (position 10351825)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 10776921
GRCz11 2 10560520
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGATTCTGGGTCTAGAGGCTGAGCTGGACACCCTGACCAAGGCTTTAGAG[T/G]AGGTGCATCTTCTCTACCACTCACTCGAAAAAGCATGTTGGGTTGATGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39775
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112829 Essential Splice Site 212 1321 6 27
ENSDART00000132167 Essential Splice Site 212 779 7 18
Genomic Location (Zv9):
Chromosome 2 (position 10350922)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 10776018
GRCz11 2 10559617
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATGCTTGAAACCCACACAGCTTAAAATTCTGGGAAATGTTTCTTTCAAA[G/A]TGCGGAGCAGCAGAGAAACCAGGCCCTTCAAAATGCTGAGAAGCTCACGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa691
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112829 Nonsense 415 1321 10 27
ENSDART00000132167 Nonsense 415 779 11 18
Genomic Location (Zv9):
Chromosome 2 (position 10335228)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 10760324
GRCz11 2 10543923
KASP Assay ID:
554-0599.1 (used for ordering genotyping assays)
KASP Sequence:
AAACATTACTTGAACCTGTTRCCCTGTTCACATACAGTAGGTGAGCGCTA[T/A]CAGAAGCTTCTGGCGGTTCTTCAGATGGTTGAGAAGGAGAAGAGCCRTCA
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa39774
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112829 Nonsense 447 1321 10 27
ENSDART00000132167 Nonsense 447 779 11 18
Genomic Location (Zv9):
Chromosome 2 (position 10335134)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 10760230
GRCz11 2 10543829
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCCGTCAGGTCAGCGCTGCTCAGAGCCTGCAGGAGAGACTGAGCAGAGCC[C/T]AGGAAGAGATCTCCTCTCTGCAGAACTCCATCACTGAGAGAGCTTCTCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14616
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112829 Nonsense 506 1321 11 27
ENSDART00000132167 Nonsense 506 779 12 18
Genomic Location (Zv9):
Chromosome 2 (position 10329038)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 10754134
GRCz11 2 10537733
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
YTGCGTGTAGCCGTCCTAGAGAAACAGCWGCAGGAGAAGAGCTCTGCTTA[T/G]TCACAGGCTGTAATGAAAACAGGRCAACTTGAASAAGACCTTCTGGTAAC
Associated Phenotype:
Not determined