Busch Lab

ZMP

dennd3a

Ensembl ID:
ENSDARG00000078797
ZFIN ID:
ZDB-GENE-091230-6
Human Orthologue:
DENND3
Human Description:
DENN/MADD domain containing 3 [Source:HGNC Symbol;Acc:29134]
Mouse Orthologue:
Dennd3
Mouse Description:
DENN/MADD domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:2146009]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa10213 Nonsense Available for shipment Available now
sa39222 Nonsense Mutation detected in F1 DNA Not yet available
sa43199 Nonsense Mutation detected in F1 DNA Not yet available
sa8874 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa13522 Essential Splice Site Available for shipment Available now
sa43200 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa10213
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115136 Nonsense 35 1270 2 23
Genomic Location (Zv9):
Chromosome 19 (position 1817932)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 1748887
GRCz11 19 1694357
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AACTTCTCTTGCTTTTTAACTTYTCGYACAGGGTAAAGAWGCAGATGTGT[T/A]RGTGGAGGCGGAGGTGCTGCAGGTTCACGCTCCACCGTTTATAACAAAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39222
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115136 Nonsense 164 1270 4 23
Genomic Location (Zv9):
Chromosome 19 (position 1820756)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 1751711
GRCz11 19 1697181
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCTTAATTTGTGTTGTGTTATTGTAGTTCCAGCAAGATAATGTGATTTA[T/A]GCAAACGGCCATCGAACCAACGAACACAAGCGTCTGTACACCACATTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43199
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115136 Nonsense 188 1270 4 23
Genomic Location (Zv9):
Chromosome 19 (position 1820828)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 1751783
GRCz11 19 1697253
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAACACAAGCGTCTGTACACCACATTCAGCATATGTGTGATCTCCAAATA[T/G]CCCTATTATAACGCCCTCAGAGACTGCCTGTCCTGGTAAGACTGCTGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8874
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115136 Essential Splice Site 934 1270 16 23
Genomic Location (Zv9):
Chromosome 19 (position 1844048)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 1774634
GRCz11 19 1720094
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATCTACGCTGCYACYAAACTGGCTTACTTTGACAAGATGAAGTCTGAGGG[T/A]GTGTTTCACTCAGCACGCGCTGTTTAAATCAACAGGAATTAAGTCTCTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13522
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115136 Essential Splice Site 970 1270 17 23
Genomic Location (Zv9):
Chromosome 19 (position 1845008)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 1775594
GRCz11 19 1721054
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTGGACCAGACGAGTCCTCAAGCAGTGGACGTKCTGCTCTACACTCCWGG[T/C]GAGTCTCTCAGACACCKCCTCACAGCAAGAACGTCRCTGGTTCTAGTCCK
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29119
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115136 Essential Splice Site 1157 1270 22 23
Genomic Location (Zv9):
Chromosome 19 (position 1859010)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 1789596
GRCz11 19 1735308
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTCTATATGAAGATGTCGATATTAATGGTGTAATTGATCTGTGGTTTCA[G/A]TCGGAGCAGCTGTGGGCTGGTTTTGCGGATGCGGGTGAGCTGTGTGTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43200
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115136 Nonsense 1228 1270 23 23
Genomic Location (Zv9):
Chromosome 19 (position 1859325)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 1789911
GRCz11 19 1735623
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCGTCACAGACAGACGAGTGCGAGGGAAGATCTACATAGTAAACACGGAC[C/T]GATATACAGTGGAGAAAGAGCTGCAGGCCCACGCCGACGCCGTTCAGACC
Associated Phenotype:
Not determined