Busch Lab

ZMP

mga

Ensembl ID:
ENSDARG00000078784
ZFIN ID:
ZDB-GENE-030603-1
Description:
MAX-interacting protein [Source:RefSeq peptide;Acc:NP_001164210]
Human Orthologue:
TBX6
Human Description:
T-box 6 [Source:HGNC Symbol;Acc:11605]
Mouse Orthologue:
Tbx6
Mouse Description:
T-box 6 Gene [Source:MGI Symbol;Acc:MGI:102539]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa36333 Nonsense Mutation detected in F1 DNA Not yet available
sa9048 Nonsense Mutation detected in F1 DNA Not yet available
sa865 Nonsense Available for shipment Available now
sa39148 Nonsense Mutation detected in F1 DNA Not yet available
sa18203 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa36333
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110593 Nonsense 174 2735 1 23
ENSDART00000137469 Nonsense 174 2648 2 24
ENSDART00000144408 None None 23 None 2

The following transcripts of ENSDARG00000078784 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 10029871)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 10415453
GRCz11 17 10571487
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACTGCAGATATAAATGGAGTGGCAAAGGATGGGAACCCAATGGGAAGGCT[G/T]AGCCTCATATTTCACGGTTGTTTGTACACCCAGAATCCCCTGCTAGTGGC
Long Flanking Sequence:
AGGGTGCAATGGTGCTTCATGAAGAGGGCGTGACTGCCCCAACACTGGCACCTCCCACAACCACTCCACCTTCCATTTTTGTTGTTTTAAAACAGTTGCAATCTAGTGATAGTGGGAATGACAAGGCTAATCTAATGGCAATTAGTGAGGCAAATAAAATGGGGAAATCCTCAATTGGCACTACTGTGGCAGGCATTCAACCAACATCCTCCACATTTGCAGACACTAACAGCACCACACCATCTGAGAACTTGCCAGCAGATGCTAGATGTAGAGGCATTACTGTGACCCTGGATAACAACAACATGTGGAACGAGTTCCATAGATGTAAGACAGAGATGATTCTGACTAAACAAGGACGTAGAATGTTCCCCTATTGCCGGTTTCGTCTCTCTGGAATGGAACCTTTCCAGAATTACGTTTTGGCAATGGATATTAAACCTGCTGATAACTGCAGATATAAATGGAGTGGCAAAGGATGGGAACCCAATGGGAAGGCT[G/T]AGCCTCATATTTCACGGTTGTTTGTACACCCAGAATCCCCTGCTAGTGGCTTACATTGGATGCAGTACCCTGTTTCATTTTACAGACTGAAACTTTGCAACACCTTGGATCAAGAGGGCCATATTATTTTGCACTCAATGCACCGATACCTTCCACAAATTCATATTATACCTGCAGACAAAGTCAGTAAAGACATTCTAATTTTGGACAGACCCAATGTTGTAACTCTCAGTTTTGCTCAGACTGAGTTTTTTGCAGTCACAGCCTATCAAAACCTTTGCATCACCCAGCTCAAGATTGACTACAACCCCTTTGCCAAAGGTTTCAGGGAGGATGCGGTCAATGCGCGATCATCTAAGGCCAAGAATGGATTGTCTACTGATGAAACAGAGAGTGAGCTCAAGCTGAGCAAGGAGATGACAACCTTGAATAACTTGAAAACACTGTTCATGAAGAGAAAAGCTTCTGTAAAGGTCAATGTGAATCAAAACGTTCCCAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9048
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110593 Nonsense 525 2735 2 23
ENSDART00000137469 Nonsense 525 2648 3 24
ENSDART00000144408 None None 23 None 2
ENSDART00000110593 Nonsense 525 2735 2 23
ENSDART00000137469 Nonsense 525 2648 3 24
ENSDART00000144408 None None 23 None 2

The following transcripts of ENSDARG00000078784 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 10028435)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 10416889
GRCz11 17 10572923
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACAAGAGACCTGAACGTGTGCCCCTGCCTCTCCTCGCTAAGTTTCTAAAA[C/T]AGAGAAGACCTATTTTGCCCAAACCTGTCTCTCACAGCTCACTCTCAGAT
Long Flanking Sequence:
ATCTCTCTTTCTCTAACAGTAACAAGAAGCGTCCATCCTCATTGGCATTCTCCGACTTCATTAAAGGTGCTCATGTGAAAGTAAAAAGGTTATCACTTGAGAATATCAACAAAACTGGTGGGGCCACGGAGCCATCTACTGCTTGCACAAGTAAACAAAAGGAGGCAGCTGATATATCATCCATAACAGAAAATTCTTTGCAGGTTGATCAAAAAGATGGAAATGGTGCAGGTGATGTTCTCAGATGTGAAAGCACAGACACGTCTTTAAAAACAGGTGTATTAAAAGCAAACGAGATTAAAAAAGAAATTGATGAACACAGTGCTGACAAGAATACATTGAAATCAAGTGACCAAAATCTATCCTGTTCGGATGAAAAAAAAATGGAGACAGTTTCTTCTCTAAGTACTGAAGCCAAGCCCGAGGCACAAATGAAGAAAACCTTACCACACAAGAGACCTGAACGTGTGCCCCTGCCTCTCCTCGCTAAGTTTCTAAAA[C/T]AGAGAAGACCTATTTTGCCCAAACCTGTCTCTCACAGCTCACTCTCAGATTCTGAAAAGTCCTGTGAACCTGCCCAAACCTCTGAAAGCTCATCTGTCTTAATGTCTTTTGTACCTTGTGTTACCACAAACCTTGATTCACAACCAGCAGTTACCTCATTATCTCAGACAGTTACATCATCAACTACAGATGCAAACAACATGACATCTCTGTCCACAACGTTATCATATTCATCGACAACTGTCCCCCTTATACCATCAGAAACACAATTATGTGATAGATTTTCAGCTTCCCCAGTTGGCAGTGATCCATTCAGTGCCCCAAACACTACCTCTCCCTCGAAACCTAATTCTAACCCAGCACTTGACATTTCTAATAACACTGATGCCATTTTCACACCAGATCATGATAACACACTCAGGTCACAGTCAGACATTTCATCCGATTCAACATGTGATGTTGTGCATGACAGTTGTCCACCAACAGTTAACACTGACACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa865
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110593 Nonsense 525 2735 2 23
ENSDART00000137469 Nonsense 525 2648 3 24
ENSDART00000144408 None None 23 None 2
ENSDART00000110593 Nonsense 525 2735 2 23
ENSDART00000137469 Nonsense 525 2648 3 24
ENSDART00000144408 None None 23 None 2

The following transcripts of ENSDARG00000078784 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 10028435)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 10416889
GRCz11 17 10572923
KASP Assay ID:
554-0767.1 (used for ordering genotyping assays)
KASP Sequence:
ACAAGAGACCTGAACGTGTGCCCCTGCCTCTCCTCGCTAAGTTTCTAAAA[C/T]AGAGAAGACCTATTTTGCCCAAACCTGTCTCTCACAGCTCACTCTCAGAT
Long Flanking Sequence:
ATCTCTCTTTCTCTAACAGTAACAAGAAGCGTCCATCCTCATTGGCATTCTCCGACTTCATTAAAGGTGCTCATGTGAAAGTAAAAAGGTTATCACTTGAGAATATCAACAAAACTGGTGGGGCCACGGAGCCATCTACTGCTTGCACAAGTAAACAAAAGGAGGCAGCTGATATATCATCCATAACAGAAAATTCTTTGCAGGTTGATCAAAAAGATGGAAATGGTGCAGGTGATGTTCTCAGATGTGAAAGCACAGACACGTCTTTAAAAACAGGTGTATTAAAAGCAAACGAGATTAAAAAAGAAATTGATGAACACAGTGCTGACAAGAATACATTGAAATCAAGTGACCAAAATCTATCCTGTTCGGATGAAAAAAAAATGGAGACAGTTTCTTCTCTAAGTACTGAAGCCAAGCCCGAGGCACAAATGAAGAAAACCTTACCACACAAGAGACCTGAACGTGTGCCCCTGCCTCTCCTCGCTAAGTTTCTAAAA[C/T]AGAGAAGACCTATTTTGCCCAAACCTGTCTCTCACAGCTCACTCTCAGATTCTGAAAAGTCCTGTGAACCTGCCCAAACCTCTGAAAGCTCATCTGTCTTAATGTCTTTTGTACCTTGTGTTACCACAAACCTTGATTCACAACCAGCAGTTACCTCATTATCTCAGACAGTTACATCATCAACTACAGATGCAAACAACATGACATCTCTGTCCACAACGTTATCATATTCATCGACAACTGTCCCCCTTATACCATCAGAAACACAATTATGTGATAGATTTTCAGCTTCCCCAGTTGGCAGTGATCCATTCAGTGCCCCAAACACTACCTCTCCCTCGAAACCTAATTCTAACCCAGCACTTGACATTTCTAATAACACTGATGCCATTTTCACACCAGATCATGATAACACACTCAGGTCACAGTCAGACATTTCATCCGATTCAACATGTGATGTTGTGCATGACAGTTGTCCACCAACAGTTAACACTGACACT
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3993
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110593 Nonsense 1121 2735 7 23
ENSDART00000137469 Nonsense 1084 2648 7 24
ENSDART00000144408 None None 23 None 2

The following transcripts of ENSDARG00000078784 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 10025773)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 10419551
GRCz11 17 10575585
KASP Assay ID:
2261-0678.1 (used for ordering genotyping assays)
KASP Sequence:
GCAGGACAGAGCAACCTCTCTGCATTTTGTAGTGACATGTTGGATGAGTA[C/A]CTGGCCAGTGAGGGCAAATTGATTGATGAACGAGCTGCCAGCTTATCACA
Long Flanking Sequence:
AATGTGTCATTCTTTTACTTAGTTGGATTGAAGTTGAATCTGCTCGACGTCACACTGGAAATTGATCTGCAATATTTGGGTGTGCAGTTACCCATACCCCCACCTGCTCTCTCACCTGAAGAAACATCATCTCAAGGTAACAGATCGTAATAATAATAACAAACTAATTACATGCATACAGATCAAGCCTAATGATTATTCAGATTTTAATCGTCGTTAATTGTTTTTTTCCTGTAGCCCAGTTTGTTTCAAGGACAGGAAAAACTTCTGACTTCACCCAAATTAAAGGTTGGAGAGATAAGTTTGCTCCCTCTGCATCACTAAGTGAAGGTATGCAATTTAAAGAGTTATTCATAAATCCTTTTTCATAAAAAACTAAATTTAGCTTTAAATGTTGATATGATACATCTGCTAAACGATTGTGATTTTGCAGGTGTGTCAAGCACAGATGCAGGACAGAGCAACCTCTCTGCATTTTGTAGTGACATGTTGGATGAGTA[C/A]CTGGCCAGTGAGGGCAAATTGATTGATGAACGAGCTGCCAGCTTATCACAGGCTGATTGTACCCCTGTAGCATACCAGCTACCCACTAAAAGCACTAGCTATGTTCGCACCCTAGATAGCGTACTTAAGAAACAAGTACCTGCTATCTTAACCCCAACAACAAATAAAGTCAAGCCAACATTTAAGTCAAAAGTTGAAAATAAATCTAAAAAACCTTTGAAGCCTGGTAAAGGAAAGCAAACAAAACCAGTCATTTCAGACGCCAAACCTCTGTGCACGAAAAAGCCACAACAGAACAAGAAATATAAAAGTAGGAAGGAATTTAAGAGTCCTGAAAAGCCTGATGTGGCTGAAGTACCAGCTTCTAATACGACTCCCATGGCTGAAGATTCTGGCTCCACATCGTCAACCTGTGCAGGTGGGCGTAGTCCAGGTTTGCCTAAGACTCTGGTGAAGCTGTTGGATGTGGAAGATGGAGCAGTGTGGGAAGGCAGACATCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39148
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110593 Nonsense 1913 2735 15 23
ENSDART00000137469 Nonsense 1979 2648 16 24
ENSDART00000144408 None None 23 None 2

The following transcripts of ENSDARG00000078784 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 10018811)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 10426513
GRCz11 17 10582547
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCTTGAGCAGTCTTCCTTCTACCCTTAAAGTTGTCCAGGGTTTTCTGGGA[C/T]AGTCTGGCACTTGCACATTAAGAATTCTCCCACCAACTACTTCAACTTCC
Long Flanking Sequence:
GTGGGACTAAAGAAAGTGCTGAAATCATTAAATCAAAAACTGGTAAAGAGCACATTTAAGCCATTTTCTTTTGCGTTAAAAAAAAAAACTCACTTTTTGGAGATTACATTTGTTGTGAAGCTGGTAAATGGTAATTAAAAATCCAAATTAGTGCAAATAAAGACTAGCATCTTTGACTCGAATTAGGTAAAAATGGAAACTTATGTAATGGCTCAGAAGACATTCATATATTTATGAATTAAACCTTACTTTTTCCCACAGCGACCATTATCCGATTGCCTGCACCACCTACAGTGTCTATGAACAAGCCTCAGGGTGGCAGTGCCACCATAGTCACATCTTCCATCCCAACAACACAAACACTGGCAAAGCCTAGTGGTACAGTACCAGTCTCTACATCTTCATCTATGGGTGGCAAGTTAATTTCACCCCCTTCATCCAAATCAGTCTCCTTGAGCAGTCTTCCTTCTACCCTTAAAGTTGTCCAGGGTTTTCTGGGA[C/T]AGTCTGGCACTTGCACATTAAGAATTCTCCCACCAACTACTTCAACTTCCTCCACTGTCCTCTCACAGAGTGGCCTCACATTGTTAAAGTCTGCAAGTTCTATGCCGCCAACACAAGACTCGAGCAATTCTGAGACCAACGTTTCTTTTAGCTCACAATCTACAGAGAAGACTGTCGTTCAGGTCTTGAAGCAGTCTACGATTGATCCTGCTAAACAAAATAGCAGCGATAATGCTAATGTGAAAGAAAAACATTTTAACAAGGCACCAGATCCCGAAGAGAAAGAGATTGGTTCTGATTCAACAGAACTAACTGATGACTCTGACCTATACAGTGACGATGACCAAGAGGATGCATCTTGTATGAGCGTAAGAGTTTCACGAGTTTTTTGTTGTAGTTCTGCAAACTGTTATTTTTGGATTTTCTTTCAGGATTTTCTTTGCTGTTCTCTAGGCTTCCGATAGAGAAGAGAAGATAGAGGATACAGATGGCATGGACTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18203
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110593 Nonsense 2406 2735 21 23
ENSDART00000137469 Nonsense 2472 2648 22 24
ENSDART00000144408 None None 23 None 2

The following transcripts of ENSDARG00000078784 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 10015611)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 10429713
GRCz11 17 10585747
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCATAACCATAAACAACTCACTTCAACCGATTGGCATCACCTCAGTTGGA[C/T]AACAATCATCTACACCAGGTTTGTCTCCAAACAGGTTAACAATTCTTTTA
Long Flanking Sequence:
TGAGTATTAAAAAACAAAAAAGTCCGGAAATGACTGAAAGTGTTCCTAAATCTACACCATCAGTCTCAGTGCCTGCAGACCTTGATGGTAATAAAAACACTCTTAACGTTCTGGATACTAATACAGTAACAACTACATCAACACCTATTCAACCATCTTTCAACTCCACTTTAGTCATGAAACCAGTCTCTATCCCAAGTCCTATTAAACATCCTCCAATCACACGTGAGAGAATGCGGCCAAACATTCTTTCGCGTGCCTCATCTCAGGCGATGCAAGGATCTCCAGTCAAAGAGTCTCTTTTAACTAATGGTTAGTATGAGAGACATTTACATATATTTGCAATGTAGATGCAACTTGGTTTCGGATGTTCACATATTTTGTTGTTTAATTCAGTGTGTATACCTCAAGTATTACCTCTGATGAATACCATGGTTCCATGCAATCAAATCATAACCATAAACAACTCACTTCAACCGATTGGCATCACCTCAGTTGGA[C/T]AACAATCATCTACACCAGGTTTGTCTCCAAACAGGTTAACAATTCTTTTAAAAGTTCTATAATGAAAAAAAAGTGGTTTGTTGATAAGCATTTGTATTGTTGTTTTTATCTTATTCAACTAGGTGTAGCCTCTGTGTCTATAGTTCCCACAATATCTCACCCGCTTCGAGTGGAAAATACTCTTCCTATGTTGCACCCTCAGTTTATTAAAATCACAAACAGTCCTGTTAATATTAACACAAAAGGTAAGTTACCCGTTTACTCTGATTATGTATATTTAGTAAGTTTCCTTTATTTAAACTTCAGAGATGTTCATTTTGATGAGATGTATTTATTTTTAAATGATTGTAATTTTCAGTGGATTCTGCAAGCCTTCCAAATATCAGCAATGTTATTTCTCTGGCGGAGAATCTAGTAGTACCACGGAAAGTTGTGGAAGATAAACCTGTTTTCCAAGCACAGCCAACATCTGTGGACAATCAGCAGAATTCTTCCAATGA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4696
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110593 Nonsense 2734 2735 23 23
ENSDART00000137469 None None 2648 None 24
ENSDART00000144408 None None 23 None 2

The following transcripts of ENSDARG00000078784 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 10014410)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 10430914
GRCz11 17 10586948
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TAATCAATCCCTCAATCCCCAATCTGGACTCAAGTGAGCAAGATACACCA[C/T]AAATGTGATCTACCAATCATTGAATCAGGTACAGCTGCTGCTCATGTTGT
Long Flanking Sequence:
AACAGTTGACTAATGAGGATGAAGATGAGAGAATTGCCGTGCCAGGTGATGTACAGTCTTGTTCTGACAAACCGGAAGATCAAGAACCGGCAGACGACCGAGCTCTAAGTCCTTTGTTCTTAACTCTAGATGAAGATCTGATGTCCCCAGACTCTAAAGATGAAATCGATATCCCACCCAAAGTGGATGACCTGGTCAAAGTTATCTTTGGGTCAGATTCCCCTTCGGTTTCATCTGAATCCGGGGTTGCACAGTCAACAAATGCTTCAAGCCCACATGCATCAACATGCAATGCTACAGGTGATGGACTTACTCCCCCACCTCTGTTGCACATGAAAGCTGCATATGAAGCTGCATCAGGCCAATCTGCCAATGAGGGAACCAGTGTGACATGGCGGCCTATGCCTAAACTGGTTCCTCTAGGGTTGAAGGCTCAAGATGCTGGTAAGGTAATCAATCCCTCAATCCCCAATCTGGACTCAAGTGAGCAAGATACACCA[C/T]AAATGTGATCTACCAATCATTGAATCAGGTACAGCTGCTGCTCATGTTGTTTAATGTACAAAATAGGATGTGTTTTTATATGTATTTATTTTTTTTGTTTGCTGTGTAAGACGTGCTGCCATGGGCACCACATATTGTGCCTCTGGGATATCCAAAGACGTTTAGTCAGTTTTACTTTATAATTTTGGCGTTATTTTTTTGTTTATTCTCAACATACTTGACCGGCAAGACGTCAATTGAATTGTCCTCTTGTATATCCACTCTTTGTGGCGATAGTCGAAAGAAGCCGTTAACTCATTCTACCCTCCATATTGGAGCTTGTTGTTTATTTCCCACTGGAGCTCATTAAAAATAAAAAGTTACTTGATCTTTAAACATAAGATTGTTACTCCCTTAGCGCCATCAAGGTGAACGGATAACAGTTGTTTCCGCTGGAGTAGGAGGGCGTTTTTTCCGGGTGACCTTTTTAGGAATAATTAAATTTACCCAGTGACTTTTAT
Associated Phenotype:
Not determined