Busch Lab

ZMP

si:ch1073-280h16.1

Ensembl ID:
ENSDARG00000078752
ZFIN ID:
ZDB-GENE-100922-142
Human Orthologue:
KIAA0226
Human Description:
KIAA0226 [Source:HGNC Symbol;Acc:28991]
Mouse Orthologue:
1700021K19Rik
Mouse Description:
RIKEN cDNA 1700021K19 gene Gene [Source:MGI Symbol;Acc:MGI:1915160]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa12122 Nonsense Available for shipment Available now
sa11314 Essential Splice Site Available for shipment Available now
sa24212 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4179
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112234 Essential Splice Site 63 914 None 21
ENSDART00000143647 None None 599 None 14

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 38163814)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 35302532
GRCz11 22 35278281
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCACAAGGACATGAACAACATCCTGGGCCAYGGACTCAAACACGAACAGG[T/A]CTGAGAAACACACACATACACATACAGTTGAAGTCAGAATTATTAGCCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12122
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112234 Nonsense 321 914 7 21
ENSDART00000143647 Nonsense 69 599 1 14
Genomic Location (Zv9):
Chromosome 22 (position 38174267)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 35312985
GRCz11 22 35288734
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGGGGACTCGGGGCGAYGCCCATACRYCGTTGGCTCCACCTCCACAGCGA[C/T]GATGCTCTYTCTCAGAGKCTCAGAAAGCCACRGGGCGGAGCTCAAGAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11314
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112234 Essential Splice Site 492 914 10 21
ENSDART00000143647 None None 599 None 14
Genomic Location (Zv9):
Chromosome 22 (position 38182115)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 35320833
GRCz11 22 35296582
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAGATACGACGCACACGACTCAAACCAGCAGCCGCCGCCTCCAGTAATCG[T/A]AAGACTCCARATTTTCTGATCKCATTTGGCTGCAAGTTGAGAWGGGAAAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7991
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112234 Essential Splice Site 615 914 14 21
ENSDART00000143647 Essential Splice Site 345 599 8 14
Genomic Location (Zv9):
Chromosome 22 (position 38187563)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 35326281
GRCz11 22 35302030
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCGCCTCTGAGCTCGACTGGCTGGTTCCAGAACAYGACGCCCCTCAAAAG[G/A]TACCTRAAGTTACATTTTTGTTCCGGAAANNTTATATAMATGCATTTATA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29829
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112234 Nonsense 694 914 17 21
ENSDART00000143647 Nonsense 424 599 11 14
Genomic Location (Zv9):
Chromosome 22 (position 38191837)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 35330555
GRCz11 22 35306304
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACTCTGTGTGTGTGTGTGTGTTTAGACTACATGAAGCGTCTGCGCTACTG[T/A]GAGTATCTGGGCCGCTACTTCTGCCAGTGCTGTCACGAAAACGCTCAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24212
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112234 Nonsense 860 914 20 21
ENSDART00000143647 Nonsense 590 599 14 14
Genomic Location (Zv9):
Chromosome 22 (position 38194219)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 35332937
GRCz11 22 35308686
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGCTTCATCTGTGAGTTCTGTGGAAACGACAAGGACATCATCTTCCCCTA[C/A]GAGCTCAACAAGTGCCTGCGCTGTGAAGGTCAGCGTGATTCCTCTTACCC
Associated Phenotype:
Not determined