Busch Lab

ZMP

si:dkey-93n13.3

Ensembl ID:
ENSDARG00000078736
ZFIN ID:
ZDB-GENE-091118-107
Human Orthologue:
DOC2A
Human Description:
double C2-like domains, alpha [Source:HGNC Symbol;Acc:2985]
Mouse Orthologue:
Doc2a
Mouse Description:
double C2, alpha Gene [Source:MGI Symbol;Acc:MGI:109446]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa19967 Essential Splice Site Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26016
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113632 Nonsense 83 407 1 11
ENSDART00000136912 Nonsense 85 405 1 9
Genomic Location (Zv9):
Chromosome 3 (position 15155366)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 15400972
GRCz11 3 15550772
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCGGGGCCTCTGGAGGGGCAAGTGGAGGCCTGTTGTCTCCATTGCAGGCT[G/T]GAGCGAGAGGAGGAGGTGGGACTCTGTCCGCAGCCAGCAGCATCGAGACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19967
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113632 Essential Splice Site 223 407 6 11
ENSDART00000136912 Essential Splice Site 219 405 4 9
Genomic Location (Zv9):
Chromosome 3 (position 15167445)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 15413051
GRCz11 3 15562851
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCGGACCAGACCAAACGTTTCTACACCTGTCTAGAACATCCACCACCTG[T/A]AAGACACTCATAAACACACGTTTAGCTTGAGCTGTTGCACTGGAGGAAAA
Associated Phenotype:
Not determined