Busch Lab

ZMP

cnnm2b

Ensembl ID:
ENSDARG00000078733
ZFIN ID:
ZDB-GENE-090311-26
Description:
Novel protein similar to H.sapiens CNNM2, cyclin M2 (CNNM2) [Source:UniProtKB/TrEMBL;Acc:B8JIF2]
Human Orthologue:
CNNM2
Human Description:
cyclin M2 [Source:HGNC Symbol;Acc:103]
Mouse Orthologue:
Cnnm2
Mouse Description:
cyclin M2 Gene [Source:MGI Symbol;Acc:MGI:2151054]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa1438 Nonsense F2 line generated Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3342
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112333 Nonsense 157 807 1 7
Genomic Location (Zv9):
Chromosome 1 (position 31179741)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 30993201
GRCz11 1 31725769
KASP Assay ID:
2259-0733.1 (used for ordering genotyping assays)
KASP Sequence:
TTTTAAACCGCAAGACGTCTGGCACCGTSGAGATAGAGGTCAAACCTCTG[C/T]GAAAGACTGAGCGGAGCAAAGCGTACTACCTGTGCATCGCCACCTCCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1438
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112333 Nonsense 740 807 7 7
Genomic Location (Zv9):
Chromosome 1 (position 31251344)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 31064804
GRCz11 1 31797372
KASP Assay ID:
554-1365.1 (used for ordering genotyping assays)
KASP Sequence:
ACATGAGCTTTTGTAAGTTGCCCTGTTCTCTTTGTTTTCAACAGGTAACG[C/T]GACAGCAGTATCARAATGCCGTCATGGCCTCACGCATAGACAAAACCCCA
Associated Phenotype:
Not determined