Busch Lab

ZMP

nos1apa

Ensembl ID:
ENSDARG00000078725
ZFIN ID:
ZDB-GENE-081024-1
Description:
Nos1ap protein [Source:UniProtKB/TrEMBL;Acc:Q5BJA3]
Human Orthologues:
NOS1AP, RP11-565P22.6
Human Description:
nitric oxide synthase 1 (neuronal) adaptor protein [Source:HGNC Symbol;Acc:16859]
Mouse Orthologue:
Nos1ap
Mouse Description:
nitric oxide synthase 1 (neuronal) adaptor protein Gene [Source:MGI Symbol;Acc:MGI:1917979]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3611
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114960 Nonsense 307 678 9 12
Genomic Location (Zv9):
Chromosome 6 (position 34607514)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 35155973
GRCz11 6 35139356
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTGAAGGGAAACGTCTGCTGTGTGCTCTTCAGGTTCATCTGCTGAAGGAT[C/T]AACTCTCTGCTGAAGCGGCAGCGAGRATTGAAGCCCAGGCTCGAGTTCAC
Long Flanking Sequence:
CATTAATGGAAAAAACTAGCAGATTGACCACATTGCACAACATCTGAAATGTTTCATTTATTATAAAATCCCTTAGCCAAAATCCATCATCACACTGGTTTGCTATTATTACCTCACAAGCCACTGCACGATCATTGCGCTTCATTTTTGTCTTTTGGTGTCTCCAGTTTTGCGCATGAGATAGATTTGCATCTTTGCATAGAAACATAGCTAATGGCTACCTGTTTACCTCAAAATTCCTTCATTTGTGTTTAACTGATGAAAAAAAAAAAACCTCAAACATATTTAGGACAATGAAGTATTCATGTATTGGGTGGTCTCTTTAACTTTGCATGACGTTTTTTTGGCTTTAAGTTTTACTGAATTTAAAAATAAAACAGAAACTTTTGTCTTCTCTGTAATAAATATGGACCAAACTCTGTTGTATGTGTGTGCGCTGGATGGACTGAACTGAAGGGAAACGTCTGCTGTGTGCTCTTCAGGTTCATCTGCTGAAGGAT[C/T]AACTCTCTGCTGAAGCGGCAGCGAGGATTGAAGCCCAGGCTCGAGTTCACCAGCTGCTGTTGCAGAATAAAGATCTCCTCCAGCACATTTCCCTGCTGGTCAAACAGATCCAGGAGCTGGAGCTCAAGCTGGCTGGACAAGGCTCTAGTGAGTATTATTTTCTCTGTTCTGCAGTGTTAGCTGTAAAAGCATGCATTGTTTTTGTGTTTGGAAGAAACATTGCTGGTTGTGCCGGTCTTTTTAACACTTAATAACAAAAGTTCAATGTAAAGTAGAATAAATTTTGTAAAGATTTAAAGAGAATTAAATGCAGGCATATGAAATTGTTTTGGTTTGTTTTTAATCTACTGATGACTTTACGCTGTACAATATGTACATGAATATATACATTGGACAACAGGGTAATACAGTAAAATTATTTACAAAGTTTGGGGATGTTTTTATTATTATTTTTTTATTATTATTTGTTGTTGTTTTTGTGTTATTGCTGTTCTTTACAT
Associated Phenotype:
Not determined