Busch Lab

ZMP

si:ch211-255f4.4

Ensembl ID:
ENSDARG00000078723
ZFIN IDs:
ZDB-GENE-050208-388, ZDB-GENE-080305-13, ZDB-GENE-080305-13
Description:
hypothetical protein LOC100006445 [Source:RefSeq peptide;Acc:NP_001108543]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa43751 Nonsense Mutation detected in F1 DNA Not yet available
sa16181 Nonsense Available for shipment Available now
sa7249 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa43751
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106601 Nonsense 200 506 4 7
ENSDART00000147547 None None 53 None 2
Genomic Location (Zv9):
Chromosome 22 (position 2678511)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 1491359
GRCz11 22 1508257
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGTCACATGTGGATCCACACTGGAGAGAAACCGTACAAGTGTTCACAATG[C/A]GACAAGAAATTCTGTAAATTACAAGACCTGAAAACACACAAGAAGATTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16181
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106601 Nonsense 377 506 6 7
ENSDART00000147547 None None 53 None 2
Genomic Location (Zv9):
Chromosome 22 (position 2679356)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 1492204
GRCz11 22 1509102
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGATGAGTGATCCAGAACCCTGCAGAATTAAACAGGAAGASMMTGAAGAA[C/T]AAAYAGGTTGGTGTTTATTCATTAMTCTTCAATAATGTAGCTGAAGAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7249
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106601 Essential Splice Site 379 506 7 7
ENSDART00000147547 None None 53 None 2
Genomic Location (Zv9):
Chromosome 22 (position 2681049)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 1493897
GRCz11 22 1510795
KASP Assay ID:
554-4865.1 (used for ordering genotyping assays)
KASP Sequence:
GCCCCGTCTGCCACTYAACACTGTCATGTRACTTATTTACTTTATTTGCA[G/A]AGGTGAAGGTGGAGAGTGAAGTACTGTGGGGAATCGAAGATGAGGAGAAA
Associated Phenotype:
Not determined