Busch Lab

ZMP

zgc:172265

Ensembl ID:
ENSDARG00000078717
ZFIN ID:
ZDB-GENE-080220-48
Description:
hypothetical protein LOC100141346 [Source:RefSeq peptide;Acc:NP_001108383]
Human Orthologue:
ITGA8
Human Description:
integrin, alpha 8 [Source:HGNC Symbol;Acc:6144]
Mouse Orthologue:
Itga8
Mouse Description:
integrin alpha 8 Gene [Source:MGI Symbol;Acc:MGI:109442]

Alleles

There are 10 alleles of this gene:

Allele Name Consequence Status Availability
sa9052 Splice Site, Nonsense Mutation detected in F1 DNA Not yet available
sa17254 Splice Site, Nonsense Available for shipment Available now
sa6436 Nonsense Mutation detected in F1 DNA Not yet available
sa2856 Essential Splice Site F2 line generated Not yet available
sa42737 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa22861 Nonsense Available for shipment Available now
sa14004 Nonsense Available for shipment Available now
sa15736 Nonsense Available for shipment Available now
sa22862 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa9052
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059038 Splice Site, Nonsense 297 1059 9 30
ENSDART00000059044 Splice Site, Nonsense 286 397 9 13
ENSDART00000141061 Splice Site, Nonsense 297 517 9 15
ENSDART00000059038 Splice Site, Nonsense 297 1059 9 30
ENSDART00000059044 Splice Site, Nonsense 286 397 9 13
ENSDART00000141061 Splice Site, Nonsense 297 517 9 15
Genomic Location (Zv9):
Chromosome 16 (position 30639409)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 28476547
GRCz11 16 28411170
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TATGCAGAATTRGTAGCAGGGGTTCCTCGAGGGGCACACAACTTTGGYTA[T/A]GTAAGTATACAGACYTTGTTTCCTGTGTTTTTGTTGTGYTAAGATCAGGA
Long Flanking Sequence:
GAAATTTGAGGTTGTGGGGGGAAGGGTTGAGGACGAACAGGCTCCTTGGAAGTCTGGGAGATTTCAAGTTCGAAACGAGTCAACCATCCCTCTCTCCAATCTCAGTGTGTGGGACAGATCTGACAGACAGCCGCAAACCCCCCCACCACATCACTATCTCCACCATCATCCATCAGTGTCTGTCTCCTTCACTATGACTCTTTCCCTCTCTCTCTTCTAAATATTTATAACTAATGAGTGACTGGCGTGCTGTTGACAGAGACGAGATTTACAGCACTCACAGGTCTCACCTCACTGTTTACCCTGAGATGCACTTGATAAGTGGTTGGAAAAGTGTGTTTTATTATTGTTCCTTGTTGAAGCACATCATTTGTTTTTTTAGACTCTGCTACTTTAAAACATATAAACCTGCTGATATGTTTGTGTACTGTATGACTTTCTCATGTTGTCTATGCAGAATTGGTAGCAGGGGTTCCTCGAGGGGCACACAACTTTGGTTA[T/A]GTAAGTATACAGACTTTGTTTCCTGTGTTTTTGTTGTGCTAAGATCAGGATTTAAAGGTCAGAGGTAAAGGTCAAAAGGAAGGAAGAACGTAAGAAATGTTTGAGAGGTTAAACACTGCTTTTGTACTAAAATTGGCACAAACATGAAAATAGTGTTACAAATTACACAACCCAAATGGTAAAAAAGGTATATACTATTGTTCCTTTTTTGACCACAAAAGGAGATGGCTAGTAGCTAGCATTTGGTTTAAAAAAATAAATGTAAAAGTGTTATAGAATGATCCAATGTGCTGTTTGTTGTGTATTCTAAGAATATCGAAAGAGCAAAACACTACATATGGAAAATACAGAACATGTAAACAGCAGGAATGGAAATAAAAGGAATGTGTAAAAACAATTAATTAGAATAATATTGGTAGTATTTAAATAGCATTTAACATCTTAATAACAATTATAATGATAATAATAAAGTTGGTGATGATAAAAGTGATATTTTGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17254
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059038 Splice Site, Nonsense 297 1059 9 30
ENSDART00000059044 Splice Site, Nonsense 286 397 9 13
ENSDART00000141061 Splice Site, Nonsense 297 517 9 15
ENSDART00000059038 Splice Site, Nonsense 297 1059 9 30
ENSDART00000059044 Splice Site, Nonsense 286 397 9 13
ENSDART00000141061 Splice Site, Nonsense 297 517 9 15
Genomic Location (Zv9):
Chromosome 16 (position 30639409)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 28476547
GRCz11 16 28411170
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TATGCAGAATTRGTAGCAGGGGTTCCTCGAGGGGCACACAACTTTGGYTA[T/A]GTAAGTATACAGACYTTGTTTCCTGTGTTTTTGTTGTGYTAAGATCAGGA
Long Flanking Sequence:
GAAATTTGAGGTTGTGGGGGGAAGGGTTGAGGACGAACAGGCTCCTTGGAAGTCTGGGAGATTTCAAGTTCGAAACGAGTCAACCATCCCTCTCTCCAATCTCAGTGTGTGGGACAGATCTGACAGACAGCCGCAAACCCCCCCACCACATCACTATCTCCACCATCATCCATCAGTGTCTGTCTCCTTCACTATGACTCTTTCCCTCTCTCTCTTCTAAATATTTATAACTAATGAGTGACTGGCGTGCTGTTGACAGAGACGAGATTTACAGCACTCACAGGTCTCACCTCACTGTTTACCCTGAGATGCACTTGATAAGTGGTTGGAAAAGTGTGTTTTATTATTGTTCCTTGTTGAAGCACATCATTTGTTTTTTTAGACTCTGCTACTTTAAAACATATAAACCTGCTGATATGTTTGTGTACTGTATGACTTTCTCATGTTGTCTATGCAGAATTGGTAGCAGGGGTTCCTCGAGGGGCACACAACTTTGGTTA[T/A]GTAAGTATACAGACTTTGTTTCCTGTGTTTTTGTTGTGCTAAGATCAGGATTTAAAGGTCAGAGGTAAAGGTCAAAAGGAAGGAAGAACGTAAGAAATGTTTGAGAGGTTAAACACTGCTTTTGTACTAAAATTGGCACAAACATGAAAATAGTGTTACAAATTACACAACCCAAATGGTAAAAAAGGTATATACTATTGTTCCTTTTTTGACCACAAAAGGAGATGGCTAGTAGCTAGCATTTGGTTTAAAAAAATAAATGTAAAAGTGTTATAGAATGATCCAATGTGCTGTTTGTTGTGTATTCTAAGAATATCGAAAGAGCAAAACACTACATATGGAAAATACAGAACATGTAAACAGCAGGAATGGAAATAAAAGGAATGTGTAAAAACAATTAATTAGAATAATATTGGTAGTATTTAAATAGCATTTAACATCTTAATAACAATTATAATGATAATAATAAAGTTGGTGATGATAAAAGTGATATTTTGTAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28677
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059038 Splice Site, Nonsense 316 1059 10 30
ENSDART00000059044 Splice Site, Nonsense 305 397 10 13
ENSDART00000141061 Splice Site, Nonsense 316 517 10 15
Genomic Location (Zv9):
Chromosome 16 (position 30641888)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 28479026
GRCz11 16 28413649
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGTGATCAATGCAACAAACCTGACGTTCATTCAGAACTTTACTGGAGAG[C/T]AGGTGATTAACCGTCTACATGACTGTACTGTATGTACAGATAGAGTTTGG
Long Flanking Sequence:
TTGAAGCCTTAAAAAGGAATTCCCAATTAGGGCTGCAGCATCTAGGACGCAGGGGTGTCCCCTTTGGCCCTCAATTAAATAGAATCATATTCAGCTGGATGGGTGGTTGGTGAAACAGACAGTGAATTTGGGTTCTTTTTTTGTTTCCAAGGCATGTTATGTTCTTGGGTATTTGCCATATGTGGCTTTGTTTGATTTAGGATCTCAGTCATACGTGCCCCATAAAACATCCACTACGATCAGTCTGGATGTAATTATTAGAGTGCTAAATGTCTAACATGCGGAAAATCACTTGGTTTGCTGCGTAGGACAGGCATGTGGTCAGATACAAAAGTCCTGGAGTACATCAGGAAATATTCCAGAATCATGACAGTCTGTCATGAATGCAAATCTTATGAGTAATAATTTAATCAGGCTGATTTTTCTTATTTTTTCTTTTTCTTTAGGTGACAGTGATCAATGCAACAAACCTGACGTTCATTCAGAACTTTACTGGAGAG[C/T]AGGTGATTAACCGTCTACATGACTGTACTGTATGTACAGATAGAGTTTGGTAGTTAGTATTACTAAATTTTACAGAGATCACTTTCATTATAGGTGTATCAAAATAAACTACAAAATACAGCAGCCACAAATGTAGCAAAATAAAATACTGTATTTTTGTATTTTAAAAATACTACAAAATACTTTTGCAAGCAAGCTTGAACCTCCTTTGCATATATTCCATGAATAGGCCTGTTTGATCAACCACTTTACTGTTAAACGTGAAGTAAACCATATTTGATTGCATCAACTTTTCTCTGAGCAAGTTTTAGCAGATTCTCTACCACCTCATTCAACTCTACTCTTACTGTACATGAATATAAATCTATACTTTTTTTACTTGTTTCTTCTTTATTCATTTAGTATATTTTTGTACAAATTTCAGTAACACTTTATGTTGATGGTCCATTTGAGTATTAGTAGACTGTCTGCTTAATCTCTGTTGATACTGCTCCCTCAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6436
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059038 Nonsense 363 1059 12 30
ENSDART00000059044 Nonsense 352 397 12 13
ENSDART00000141061 Nonsense 363 517 12 15
Genomic Location (Zv9):
Chromosome 16 (position 30648369)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 28485507
GRCz11 16 28420130
KASP Assay ID:
554-4434.1 (used for ordering genotyping assays)
KASP Sequence:
GACCGCGAGTTTGAGAGTAAGCCTCGAGAGGTGGGCCGGGTTTAYTTATA[T/A]CTGCAAGAAGATGTGCTTCTCTTCTCTYCTCCCATCACACTCACTGGAAT
Long Flanking Sequence:
TCACTAGAAATCTATAAGCAGGTGTGTGTGATTAGAGTTGGAGCTAAACTGTGCAGCACACTGGCCCTCCAGGACTGAGTTTGCCCACCCCTGGTGTAGTACATACAATAGTTGAAGCTGAGAACTTAAGCATGCATGCAAAAGATGCAATATGTAAACAATCCCTCACTCTGAAAAAGATTTGATTTTCTAGAATTTGTCATGCCCAACCTATATTGCTATTGCTGAAAGGATCATCCCTTTATCCTTCATCTGACATCCTGACAATTGAAATGGATTGGTCAGAATATTGAGGAAATTTCTATTTGGTACCAAGTAAACACCAATAATTATGGGTCTTATGGGACACTAAAATGTATTGTATCATAAAAAATGGATTTGTATCATGTTTGTGATTTTATGTGCTTACTCAGGTTAGACGACGTGCTAGTTGGAGCTCCACTCTATATGGACCGCGAGTTTGAGAGTAAGCCTCGAGAGGTGGGCCGGGTTTATTTATA[T/A]CTGCAAGAAGATGTGCTTCTCTTCTCTCCTCCCATCACACTCACTGGAATGCACCTGTTTGGCCGCTATGGAAGTGCCATTGCTCCTCTTGGAGATATCAACCAGGATGGCTATCTTGGTAAGTAATTATTTTATTGCATGTTTTGGCTGTTGTTTTGCATGTATTGTGGGTTTTTTCTAATGTCGGTAAGGCAGAAGTTAAATTCACACCCATTTCCTACTTGCTTTTTTGTGTAGGAAATCCTGCTTCTCTGTCACATACATAGAAGTTTCAGTTCTTAGGCAGTCAGGAAGGGTAAAATTAGTGATTTGTTGCCCTTGTCTGCATGTTCCTGTGAAGAGTTGGGTGTTAACCGCTGATTTGTTGAGACTTCAAATTGAGGTCACTTGGTAAATATTCCTGTTGCTAGTCAAACCAGTATTATTGCAAAAATAATAACTATAAAAATATTATTATTATTATATAAAATCTATTAATATTTAAATACCTAAAATATAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2856
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059038 Essential Splice Site 482 1059 14 30
ENSDART00000059044 None None 397 None 13
ENSDART00000141061 Essential Splice Site 482 517 14 15
Genomic Location (Zv9):
Chromosome 16 (position 30674074)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 28511212
GRCz11 16 28445835
KASP Assay ID:
554-3020.1 (used for ordering genotyping assays)
KASP Sequence:
CAGATTTGCTGGTCGGTGCATTTGGAGTGAGTAAAGTYGTGGCCTACAGG[T/A]GAGAAATTTTACACCTTGAATTCACTAGAAAGTTGACAMTGNYTTTTTATA
Long Flanking Sequence:
GCCATAATACACTTAAAGCACATTATGATAATGGCACTGCATCCCATTAAAATCTCATATATTGCAGGTTTATCAAGCCCACCTTCATCAGGAGAAGAGTAAAACCATTCTGCATATTGTATTTACCTTTCCCGTAATCAGATGTGGCTCTGTGCACCTCTGAGTGGAATGAAATGAAAGGCTCACACATTCTCCCTGGCTCTCTGGGGTTTCTCTTTGACTCTGTTCAGGGATGGCAGGTGATGTAAGATGCGAGGCTGGTCGAATGAGAAACGGCTCAGCGAATCTTTGATGGAGTCTGCTGGAGGCCCAAATAACTTCCAGCTGTAGTTGCCTTTGAGGCTTTATGATCCAGCCACTCGTTCCCTTTCCTTTTCTTTCTCCTGCAACACGTTTTTCTGCATCATATCATGTTCCTTCTGCACCTCTCAGTTCATTTTACTCTCTTCACAGATTTGCTGGTCGGTGCATTTGGAGTGAGTAAAGTCGTGGCCTACAGG[T/A]GAGAAATTTTACACCTTGAATTCACTAGAAAGTTGACAATGTTTTTTATAGTTGATTATGCATATAGTATATACACTACCTAACAAAAGTCTTGTTGACGTTCTTAGTTGCAAGAGCAACAAATAATAGCTTGACTTCTAATTGATCATTTGGAATAAACAAAAACTGCAAAAGATCTATTGGAACCCGCATGGACCCTAGATTCTTACAGAAATCCGTCGAGTTTGGTAAAGGAAAAATCATAGTTTGGCATTGCATTCAGTATGGTGACATGGGAGAGATCTGCAGAGTGGATGGCAACATCAACAACCTGAGGTATCCAAACATTTAAGCTGCCCATTGCATTACAAACCACAGGAGAGTGCAAATTCTTTAGCAGTAAAGTGCTGCTTTTTATTCTTCAGCCTCCACATCAAAGTTCCTGAAAGCAAAGAAGCTCAAGGTGCTGCAGGATTGGCCAGCCCAGTCACCAGAAATTAACATTATTGAGCATGTCTGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42737
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059038 Essential Splice Site 589 1059 18 30
ENSDART00000059044 None None 397 None 13
ENSDART00000141061 None None 517 None 15
Genomic Location (Zv9):
Chromosome 16 (position 30688556)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 28525694
GRCz11 16 28460317
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGAGATCTTTTTCTCTCTGTTGTTGTTTCATCCTGCTCTGTTTGTGTGT[A/C]GGATGAGGCCGAGTTCAGGGATAAACTGAGTCCTATCAGCGTGACACTGA
Long Flanking Sequence:
CAAGATTCAGCAACGTGTGTGTTTGACAGGTGTACAAATAGTTTGTGTGATTAGTCCTGAACAGCTTCAGCTGTGTCTGTTTGCAATCATGGGGATCTAGGCCAGGTGTATGATTGAAGCGCATGATGGGACTTGTAGTGCAGTTAAATGTGAGTGTTGTCCAGCAGCCTGCAAAAACAACACTGCTGGTGATCATAACAGCTGTATTCCTGCTTTTGTGTTTACAGGCTTTTCCTACTTAAATGCGCGTTTCAGTTTAGAAACATAAACATATGTTCTCATTTTCTAAAAGCCTTGTACCTAATTAAATAATAGCATTTATAGCCCTTGACTTTCTAAGACAAGCGTGCTTATACCACAGATGTGACTTTTCTCTGTTTAATATGTGAAGGAATCTGCTATCAAAAGACAAACATCAGTAAAAGAGTGAAAATATAAAGTGAAACTAACATGAGATCTTTTTCTCTCTGTTGTTGTTTCATCCTGCTCTGTTTGTGTGT[A/C]GGATGAGGCCGAGTTCAGGGATAAACTGAGTCCTATCAGCGTGACACTGAACTACAGTCTGGACCAAAGCTCTCCTCCTGCTGGCCTACAGCTGCGGCCTGTGTTGGATCACTACAGCAAGACCTTCCACCACGAGCAGGTTCACATTCAGTGTTTATTGCTAATTATTAATAGGTATCATCAAACATCAACAGCTGATTACATCGGGTATTGCAAACATTTTCTTTTGTATTTATTTTTTTGTTTTATAATGTTTAGACATGCAAATAAGCCATATATTTGAACCACAAAAATCAGAACAATGAATAAAATATAATATATATAATTATATTGAAATAAAAATAATTACTCTGACTTTATCCAGTGTTCAGATTTCTGTGCTATATGTTGTTTATATATTAAAGGTGTGAACCTACACTGGTCTCACTGACGATTCGGTTATGATTATCATGCCATTGGTTTAGTTAAATTCAATATCTCGGTGCATCACAGTGCATTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22861
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059038 Nonsense 669 1059 20 30
ENSDART00000059044 None None 397 None 13
ENSDART00000141061 None None 517 None 15
Genomic Location (Zv9):
Chromosome 16 (position 30691770)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 28528908
GRCz11 16 28463531
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATGTTTCTGTATAGGGACCGGACTGAGCTTATAATCGGGGATGACAACT[T/A]GCTGATGTTGACTATTAATGCAGCCAATGAGGGTGAGGGGGCGTATGAGG
Long Flanking Sequence:
ACAAATTGATAATGTGACAAAAGTATCACTTAAAATGCTTTCCTGACATTAGACTTCATGAAAAAACACTGTGAAAATCTCAAAATCGACAGGTGCATGTGCTTTTATTCTTACAGTGTCTCACCTGAGGTATAAAAAAAACATACAGTATGTTAAATTCCTTGAACAAGCATAAAAAACAGAAAGAGAAAATCTATTTTTCCATTCCTCTTAGGCAAACATCCTGTTGGACTGTGGAGAAGACAACATGTGCATCCCAGATCTCAAACTCTCTGCTAAAATGTGAGTCTGAGAGTCTGTTGTGTTCATATATGTGCCACTGAGCATTGTTTACATACTTGTTGTAATTTATGTCCTGTGTTGTATCATGCATCCTTTGTTTATGTTTTAACCACATGCTGTTCTCTCATCTGTATCTAAACGTCAAGTGATTTTAAATACAGCTTTCCTTATGTTTCTGTATAGGGACCGGACTGAGCTTATAATCGGGGATGACAACT[T/A]GCTGATGTTGACTATTAATGCAGCCAATGAGGGTGAGGGGGCGTATGAGGCGGAGCTTCACGTGACCCTCCCACCAGAGGCAGATTATATAGGTGTGGAGCGTAGGCGTGAGGTAAACAACTACACTCTGTCCTTATTTACATGTATGTGTGTCTTGCCATCACTGTGTTTTGCAGATATGTTTGCAGATGTGGCTCTGGGTGGGCGAAGTTAATAAATAGTCAGTGAAATTTTTTTGCATGATGTCTTTCATTTATAGTGAATCTGATTGTGAGAGGTTTATTTTAGTCTCAGACTTGATCACTGCTGTGTTTAGAATAGATTGTGACTCACTCACTGGATCCTCTATCCAGGAAAACTGATTATGCAGAAGTTTATTTTGCTGAACTGGTTTACCCTTTAGTTTATACATTGTATATAAACACTGCACATGTGTTAAATATAGTTATTAGAAGCTAGATCTGTCGGTCTGTCTATCTATTGTTCTATCATTTGATCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14004
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059038 Nonsense 904 1059 26 30
ENSDART00000059044 None None 397 None 13
ENSDART00000141061 None None 517 None 15
Genomic Location (Zv9):
Chromosome 16 (position 30726109)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 28563247
GRCz11 16 28497870
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAGAGTTACTGGGCTTCCTGAGGAACAGCAGCGGAGTGACCCGCCGAAGA[C/T]GATCTGTTTCTATAGGCCAAAGCTACARYAGCAAAACACTGGTACAAACA
Long Flanking Sequence:
TTGGCGCAGTGGGTAGCACAATCGCCTCGCAGCAAGAAGGTTGCTGGTTCGAGCCCTGGCTAGGTCAGTTGGCATTCCTGTGTGGAGTTTGCATGTTCTTCCTGTGTTCGCGTGGGTTTCCTCCGGGTGCTCTGGTTTCCCCCACAGTCCAAAGAATTGGGTACAGGTGTGTGAAGGAGTGTTTCCCAGTGCTGGGTTGTGTATAAAACATATGCTGGAGAAGTTGGCGGTTCATTCCGCTTTGGTGACCCCAGATTAATAAAGGGACTAAGCCAAAAAGAAAATGAATGAATGAATGAATGAATGAATGAATGAATGAATTAGCATTACTAAATAATACTAAAATATTACAGATTTTATTATTTTCTACACACACTGTTTTTGTATGATATTAATTGCATCTCTGTATTTCTTCTGCATGCTTGTAGACCTCGACTCTTCAGGACACTCCAGAGTTACTGGGCTTCCTGAGGAACAGCAGCGGAGTGACCCGCCGAAGA[C/T]GATCTGTTTCTATAGGCCAAAGCTACAACAGCAAAACACTGGTACAAACACAAACAACCCATCTGAACACACAAAACCATCTCCTACATGTGACAGATTGACTCATATGTTGAACTTGACTTGTATTGGGGACCTGTGTTGACCTCAGAGGGCGAGTTCACCTGTAAATCTCCTAACAGCTCATCCATATTATGCTTATTGTCTCTTTAGGGGATTTGTGTGTGCTCATGGGACAGATGGTTTTCATAATCATAGTCCATCTCGCCACAGGTTATAAGATAAGTTGGAGCACAGGTCAAGTCAAAACTGATGGCATTCATATTACATGCACATCAGCACTCAAAAATGAAAATGTAAATACTTTAAATCGCTCACAATCAAGTGTGAGGCTTTAACACACAGCATATCTGGTACAATGAGGTCAAGATGCTTATACTGTATATGAATTTTAGATTTTTTAACTTGCCCTCCAATTTTTGGGAAGTGTAATATTGTGCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15736
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059038 Nonsense 979 1059 28 30
ENSDART00000059044 None None 397 None 13
ENSDART00000141061 None None 517 None 15
Genomic Location (Zv9):
Chromosome 16 (position 30732696)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 28569834
GRCz11 16 28504457
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CGCTAAACTCCACAGTGTCCTTTCAAGTGACRGCCATGCCTTATCGCATC[A/T]AAGCTGAGASACTCCCACGCCAGAGCAAATCAGTGAGTAATACAATTGTG
Long Flanking Sequence:
CAAATGTTCTCCTGGTGTCACAGGACATGACATCACCGGTACAGTTAGACACCTTAAACACCTCAGTCATGTGACATTGTTAACCATGACATCATCTGAACAAAATGCCTTTCATCTCACCTCCAGAGGAACGTCCACAGAAAGCAGACACATGTATAAAAGCACGTTCGCTGACGTGTGTATGTGCGAGAGTGATCCTAGTTTAAAGGAAGTGCTTTAAGTTTTTGTTTTGCTGCTCTTTTGACCATTGCTTCTCACTAAGCCTCATTCATGCTGAAGCCATTACAACCCAGCGCACTGTCAGACACCCGCCATGTGCGTCCTGTTAATGCTAATCTGACATTTTCCTCTCCGGCGAGGGGGTCGGAGTCTATTCTGAGATGTTTCCATGTGTGTTGTATTTGCGCTAATCCATTGCTTTCCTCTGGCAGAGAAGGAATGACCACTACACGCTAAACTCCACAGTGTCCTTTCAAGTGACGGCCATGCCTTATCGCATC[A/T]AAGCTGAGACACTCCCACGCCAGAGCAAATCAGTGAGTAATACAATTGTGATTGTGTGGGCACAGATTAATGAAGAAAACAACAGACGATGTGGCTGAAAGACAAGATTTTTTTTACTTAAACCCAAAGCATACTTAGTTTTTTTATGTACGCTTACAAAAACAATGATCGACAAACTTTGTCCCCTTACTCATGCACTCATCAACTTGGGTGTCTGTTGTTTTTATCATTTTCAGTAGTTTGTTGTTGTTTCTTTTATTCCGATTGTATAAATACAGCTTGGTTCAGTGTTGCCACCTGGTGGATAAACTAAATAGTGCAAAATATGTAATAATAAAGTATATTCTGACCATACCCAGCAAACAATTTTTGTGTTTAAAAGTTATCTAAAAATAGACAGCTTGGCTAAAACAAAGCTAAACTTGGGCTGTCAGTGAAACCTAATACACGTTTAAGATTAGACCAAAACTAGACTAGTCGTCAAATAGACAAATTAGACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22862
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059038 Essential Splice Site 1030 1059 29 30
ENSDART00000059044 None None 397 None 13
ENSDART00000141061 None None 517 None 15
Genomic Location (Zv9):
Chromosome 16 (position 30735530)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 28572668
GRCz11 16 28507291
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TACTGCTGGGACTGCTGGTGCTGGCAGTGCTTAGCCTAGCAATGTGGAAG[G/A]TAGGTCATAAAAAAGACTGAAAATACATGTTTATGATACTGTTGGTTATT
Long Flanking Sequence:
CTAAACATATCTTATTATTCTTAAAAGTGTAACGGATAGCTATATCCTTTTAGTGCCACAGTACTTTTTTAAAAACCCTCTTGATGTCTATTAACAGCATTGTCAGCATTTCTTAGCTAAGTGCTGTAAGCAAATCATTAAGACTCCCAATTTCTACTCTATGTACCATGTAAAACTGTCAAAAAAGGAGGGAAAAAGCAATAAACAAAACTTTCTGAAGGAGCTTCTGTTACATTTAGTCGTAAGATGATTCAGAGATGAGAGATGATAACGGAAAATGAGCTGCCAGTCTGATTTACGTGTGCTAATATCGTAGCTACATCAGTTCTAGTGAAATATTAATGACCTCTGTGTTTGTGTTCGCTTGTGTTTTTAAGATCGGCACGTTTGTGGTGTGGGCCATTCCTGACGTCTCCTTTGCCATTCCCCTGTGGGTCATAATTCTGGCTATACTGCTGGGACTGCTGGTGCTGGCAGTGCTTAGCCTAGCAATGTGGAAG[G/A]TAGGTCATAAAAAAGACTGAAAATACATGTTTATGATACTGTTGGTTATTTATTTGTTTATTTTATTTTTTTTATTTTTTTTCAAATAAATGCTGTTTGAACCTTCTATCAATCAAATGATTCTAAAATGCATCATGTTTTCCACAAAGTATTAAAGCAAGACAAGTAAAACTTTTTTATGCACCTGTCAATTTTATGGTTTTAAGGTTGTTTGGCTTTAATTAAATGTTAGTCTAATGTAAAGAATAGATCCACAACACACTTTTAAGTGTTTCTTTTGTCACAATATATCTTATATATCAATATATCTATATAACACATTGTGTCTATGTCTATGCTTATATGTTAGTTTTCTCCAACAATGAGCCGTAACCATCTCTCTCGTTACAAAGTTCACGCGAACGCACACACACACACGTGGATGCACATTAATATCCTCTGCTGTATGGATATTTGTTATGTTATTAATCAGGTATGGTAAACAAACCAGGATTGAATGG
Associated Phenotype:
Not determined