Busch Lab

ZMP

sema7a

Ensembl ID:
ENSDARG00000078707
ZFIN ID:
ZDB-GENE-030131-3633
Description:
semaphorin-7A [Source:RefSeq peptide;Acc:NP_001108357]
Human Orthologue:
SEMA7A
Human Description:
semaphorin 7A, GPI membrane anchor (John Milton Hagen blood group) [Source:HGNC Symbol;Acc:10741]
Mouse Orthologue:
Sema7a
Mouse Description:
sema domain, immunoglobulin domain (Ig), and GPI membrane anchor, (semaphorin) 7A Gene [Source:MGI S

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa38090 Nonsense Available for shipment Available now
sa24691 Nonsense Available for shipment Available now
sa44317 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa38090
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127274 Nonsense 126 640 4 14
Genomic Location (Zv9):
Chromosome 25 (position 27712218)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 26402312
GRCz11 25 26845514
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGACTTTTCAAAACTGCAAATTTGTATGTGGGACAAATGGAGAAGAGCCA[C/T]AGTGCTGGGAACTGGTAAGAGAACTTATTAGTAGTGCAATATTTTTGGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24691
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127274 Nonsense 212 640 7 14
Genomic Location (Zv9):
Chromosome 25 (position 27713517)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 26403611
GRCz11 25 26846813
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACTCTCCCACACAGAACCTACTTTTATCTCCAGTTTCCTGGCCAAGCGC[A/T]AAAATGACTCCTTGAATGAGAAGATATATGTCCTATTCCGAGAAAAAAAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30274
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127274 Essential Splice Site 307 640 8 14
Genomic Location (Zv9):
Chromosome 25 (position 27720226)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 26410320
GRCz11 25 26853522
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGAGGACTGGAGGGATTCACTAGTTTATGCACTCTTCTCCAGTAGCTGG[T/G]AAACACTTTATCTTTTGGGATTTATAAAAGCAATATTTGGCCCATACTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44317
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127274 Nonsense 569 640 14 14
Genomic Location (Zv9):
Chromosome 25 (position 27733218)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 26423312
GRCz11 25 26866514
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATCATGCCAGTTATAGATGGGAACACGGGGGCAAAAGCAACCCATGTCAA[C/T]AGACCCAATCGGAATACCTCCTCCTAATCCCAGCTATGACGGCTGAGAAT
Associated Phenotype:
Not determined