Busch Lab

ZMP

prdm13

Ensembl ID:
ENSDARG00000078701
ZFIN ID:
ZDB-GENE-080616-1
Description:
PR domain containing 13 [Source:UniProtKB/TrEMBL;Acc:A5XCE2]
Human Orthologue:
PRDM13
Human Description:
PR domain containing 13 [Source:HGNC Symbol;Acc:13998]
Mouse Orthologue:
Prdm13
Mouse Description:
PR domain containing 13 Gene [Source:MGI Symbol;Acc:MGI:2448528]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa11161 Essential Splice Site Available for shipment Available now
sa16464 Nonsense Available for shipment Available now
sa32101 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11161
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108510 Essential Splice Site 45 615 1 5
ENSDART00000136759 Essential Splice Site 47 308 1 4
Genomic Location (Zv9):
Chromosome 16 (position 35064403)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 32795903
GRCz11 16 32749933
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AACTGGGAAAGTATGTTTCGGACCGCAAGGAACTTGGAGTAAAAAAGAAG[G/A]TAAGTYCGTTTGATTTATTTCCTTAAAGAAAGGCGTTTTCTTGAAATATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16464
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108510 Nonsense 137 615 4 5
ENSDART00000136759 Nonsense 139 308 4 4
Genomic Location (Zv9):
Chromosome 16 (position 35068317)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 32799817
GRCz11 16 32753847
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AACTAATGGTTATGACATTTTGTTTCAGGTGAGGAGCGATACATTTGCTG[G/A]TATTGTTGGAGAATATTCAAATACCCGAACACCTTGAAAGCTCATGTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32101
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108510 Nonsense 515 615 4 5
ENSDART00000136759 None None 308 4 4
Genomic Location (Zv9):
Chromosome 16 (position 35069451)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 32800951
GRCz11 16 32754981
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGGTTGAAGATTCACATGAGGACTCATACAGGCTACAAACCACTCAAATG[C/A]AAAGTGTGCTTCAGGCCTTTTGGCGATCCGAGCAATCTGAACAAACACAT
Associated Phenotype:
Not determined