Busch Lab

ZMP

SYNPO2L (1 of 2)

Ensembl ID:
ENSDARG00000078696
Description:
synaptopodin 2-like [Source:HGNC Symbol;Acc:23532]
Human Orthologue:
SYNPO2L
Human Description:
synaptopodin 2-like [Source:HGNC Symbol;Acc:23532]
Mouse Orthologue:
Synpo2l
Mouse Description:
synaptopodin 2-like Gene [Source:MGI Symbol;Acc:MGI:1916010]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa15089 Essential Splice Site Available for shipment Available now
sa42039 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa15089
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113978 Essential Splice Site 106 951 4 12
Genomic Location (Zv9):
Chromosome 12 (position 27994171)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 26331780
GRCz11 12 26423140
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TACTTGTGGGTCGTGCTCCCTCCCCTCGAATTGATAAGGAGTACCGGGCA[G/A]CCTTGAGAGCCCTGTCGCCTCCACTTTCCTCGAAACCATCCGGTGTCAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42039
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113978 Essential Splice Site 253 951 5 12
Genomic Location (Zv9):
Chromosome 12 (position 27993531)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 26331140
GRCz11 12 26422500
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTGGACGAAGAACTCACTGTTACATACATGGACAAGGCCCGGCAAGCCA[G/A]TGAGTACCAGTCATCCTTTTAAAATAGCCCATATGTACAGTACATTCTTA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4467
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113978 Nonsense 726 951 10 12
Genomic Location (Zv9):
Chromosome 12 (position 27983041)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 26320650
GRCz11 12 26412010
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTGAGATGCCACAGATGCGAGGTAAAGGTGCAGAGCTGTTTGCACGTAGA[C/T]AGAGTCGCATGGATCGCTATGTGGTAGATAAACAGCCCAAATCTCCAGCA
Associated Phenotype:
Not determined