Busch Lab

ZMP

TGFBR3

Ensembl ID:
ENSDARG00000078670
Description:
transforming growth factor, beta receptor III [Source:HGNC Symbol;Acc:11774]
Human Orthologue:
TGFBR3
Human Description:
transforming growth factor, beta receptor III [Source:HGNC Symbol;Acc:11774]
Mouse Orthologue:
Tgfbr3
Mouse Description:
transforming growth factor, beta receptor III Gene [Source:MGI Symbol;Acc:MGI:104637]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa15029 Splice Site, Nonsense Available for shipment Available now
sa33849 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa15029
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109313 Splice Site, Nonsense 722 848 13 15
Genomic Location (Zv9):
Chromosome 6 (position 20785508)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 24473402
GRCz11 6 24573211
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGYTTACACCTGGATCTTGTTCTGWYRTTCCTGCTTTTCTCTTTGTAGTG[T/A]ATGTTACCGGATGAAGCCTGCACTTCCCTCAGTATAGAGAGCATCCTACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33849
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109313 Nonsense 821 848 15 15
Genomic Location (Zv9):
Chromosome 6 (position 20810855)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 24498749
GRCz11 6 24598558
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCTCAATGTTTTCAGGTGGCACAGCTGCAGGACAGCAGGTGCCGAGTTG[T/A]CCGCCAGTGTCTGAAAACAGCAGCGCGGCTCACAGTATCGGCAGCACACA
Associated Phenotype:
Not determined