Busch Lab

ZMP

si:ch211-106i3.6

Ensembl ID:
ENSDARG00000078658
ZFIN ID:
ZDB-GENE-091204-264
Human Orthologue:
FAM48A
Human Description:
family with sequence similarity 48, member A [Source:HGNC Symbol;Acc:20596]
Mouse Orthologue:
Fam48a
Mouse Description:
family with sequence similarity 48, member A Gene [Source:MGI Symbol;Acc:MGI:1929651]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3750
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108670 Essential Splice Site 238 794 7 22
ENSDART00000135338 None None 256 None 7
ENSDART00000147805 Essential Splice Site 235 829 9 24
Genomic Location (Zv9):
Chromosome 10 (position 36065598)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 35098300
GRCz11 10 35042160
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACCGTCTGCTCTACAACAAACAGAAGATGAACAYGCGCTCCATGAAACGG[T/G]GACGCTCCAGCTTCTCATTAAGGCCTAATCTTAATTCWAATTTTTTACCC
Long Flanking Sequence:
CTATGAAAAAGACTCCCATACATCAAACTTGCCTGATGTGGGTTTCCTAACCGTAAACTGACCGTTTTCTAATGCAGGCTGGAGGACAGCGCATCTTCACTTTGCTCTCACATGCTGGTAAAGCCAACATGTCAGGTCACGTGGCTCCTGTACCGCGGGAATCCAGACCTCTAATTTGAAGAATATTAATAAATGTTAAATAATAAATTGCTGTTCAATTTAATGCGTCCTTGCTGAATTAAAAAAAACTGTACAGATCTCAATGATGTATGATGAGCAGTATGAACACTGACCATGAAAGTGGCCGATTCAGTACAGATGATTGTGCATTGACTGCGATGTTGTGAATGTGTTTGCAGGATGATAAACTTCAGCTGGAGAGTCAGTTGATTCTGGCTACAGCAGAGCCTCTGTGTCTCGACCCCTCCATCTCTGTCAGCTGCACCACCAACCGTCTGCTCTACAACAAACAGAAGATGAACACGCGCTCCATGAAACGG[T/G]GACGCTCCAGCTTCTCATTAAGGCCTAATCTTAATTCTAATTTTTTACCCCTACCCTATCTCCTTGTAGGGGTAGGGGTGTACCAATTCTCTTTAGCTTGAAGGTGTAGGGGTAAGGGGAAAGGATAGATAGGTAAGGGGTAAAATTGAGATTAGGAAGTGTTTTTGTTTGGCTTTTCTACACACCACCTTTCAAATGTCTGAGGAGACTTAACTAATATCGCAAATGTCTTTGGATTAGGCAGACCAAATTTAGTGTTGGTCTGATTACAATTTTCAGGAGGAGTTTGTTACAGTGCAAAACATGCCATTTTCTTTCATGCGCAGAACTGGAATATCACAAATCTAAAAATATTTGTGAATAAAGTGCAGATTTCATCCAGTGAGGCAAAGAGAATAAAATCATCACATAAAAGACGGTATTTTGAAGAGTGTTGGAAACCTGTAACCATTTACTTGCGTACTATTTGTTTTTCCTACAATGGAAGTCAATGGTTACAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27644
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108670 Nonsense 456 794 14 22
ENSDART00000135338 None None 256 None 7
ENSDART00000147805 Nonsense 453 829 16 24
Genomic Location (Zv9):
Chromosome 10 (position 36056248)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 35088950
GRCz11 10 35032810
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTTCTCTGCTCTGGTCCAGTCTTCGGTTTTAGGAAAAGGTGTCAAACAC[A/T]GACCTCCTCCTATCAAATTGCCAGCCGGCTCAGCCTGCGCCTCCTCAGGT
Long Flanking Sequence:
AAAATTCTTTACAATATAATATAAAGATCATATTCCATTAAGATATTTTGTAAATTTCCTGCTCTAAAAATATCAAAGCTTAATTTTGGGTTTAATGTCTTGTTAAGTAATTAATTGGGACAACTTTAAAGGCACTTTTTTTAAAATAATCAGATTTTTAATTAGTTGTATCTCAGCCAAATATCATATCCTTACAAAACCATCAATGAATAAAGCATATTTATTCAGCATTCAGGTAGTGTATAAAGCCCAATTTCAGAAAACTGACCCTTATGTCTGCTTTTGTGGTTCAGTATCACATTTCAGGATGATTTGCATGTGTTAGATGTAGTAATTGGGCATCAGAATAGTTTCCTGCACCAGAAACAAAATGCATGTGAGTTTTATTGCATGACTTAGAGCAGAATCAGTATATTTTGATGGCTGTTTGTTGCTTTTTGCAGACTGATGGTTTCTCTGCTCTGGTCCAGTCTTCGGTTTTAGGAAAAGGTGTCAAACAC[A/T]GACCTCCTCCTATCAAATTGCCAGCCGGCTCAGCCTGCGCCTCCTCAGGTGAGATACACTTTAACTCCGGTGAGACGTGTGTACATCAGAGGTGTGGGAAATTTATTGTCTGGGGTACTGTAATAATTGTCATAAAGATTGTAATGAGGTTAGAGCTGACTATTTGGTGTCACTTGCTTTTCAAAAATAAAAACATGCAAAAAAAATCTTTATTGTGGCAAAGCATTTAATACATGAAGACTATTATAAACTAAGAATGGCTCCATAATTTAAGTTATTATAATTATGTAAAATAATTTTTGCATTTTGTTAATTTATGCTTATAAGATATGAGATATTCGCTCCCAGTCAAAAATTTGGTAAGAAAATGTAAGATTTCTAAATGTTTTAAAAGAAAATAATACTGTATACCAAGTCTGGATTTATTTATTCAAATTTTTTAAAAATTGTAAAAGTAAACATTTATAAAAATGTGAAATATTACATTACTGTTTTCTCAT
Associated Phenotype:
Not determined