Busch Lab

ZMP

il21rl

Ensembl ID:
ENSDARG00000078649
ZFIN ID:
ZDB-GENE-080108-7
Description:
interleukin 21 receptor, like [Source:RefSeq peptide;Acc:NP_001106981]
Human Orthologue:
IL21R
Human Description:
interleukin 21 receptor [Source:HGNC Symbol;Acc:6006]
Mouse Orthologue:
Il21r
Mouse Description:
interleukin 21 receptor Gene [Source:MGI Symbol;Acc:MGI:1890475]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa31353 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa31353
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086417 Essential Splice Site 68 253 2 5
Genomic Location (Zv9):
Chromosome 3 (position 45364693)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 47374246
GRCz11 3 45326580
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGTAAACATTACACCATTGTTTTACAATGAATATACACTTTTTTTTTGT[A/G]GGTCAGTGCAAAACATCATGTATATAAGGAGGAGATTGAGATCGAAAATA
Associated Phenotype:
Not determined