Busch Lab

ZMP

samsn1b

Ensembl ID:
ENSDARG00000078647
ZFIN ID:
ZDB-GENE-041010-135
Description:
SAM domain-containing protein SAMSN-1 [Source:RefSeq peptide;Acc:NP_001006039]
Human Orthologue:
SAMSN1
Human Description:
SAM domain, SH3 domain and nuclear localization signals 1 [Source:HGNC Symbol;Acc:10528]
Mouse Orthologue:
Samsn1
Mouse Description:
SAM domain, SH3 domain and nuclear localization signals, 1 Gene [Source:MGI Symbol;Acc:MGI:1914992]

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa15266 Nonsense Available for shipment Available now
sa21788 Essential Splice Site Available for shipment Available now
sa27661 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa21789 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27660
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110609 Essential Splice Site 9 676 2 16
ENSDART00000112457 None None 354 None 8
Genomic Location (Zv9):
Chromosome 10 (position 39766818)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 38456789
GRCz11 10 38400547
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTTTCTTAAAGTGAATGTCTTTTTGTATTTCTTACTTTGTGTTTGTTCC[A/T]GGATGGCTCAACAGACAGCCTGTATGAACCGGCTCAGATTGGTCAGAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15266
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110609 Nonsense 293 676 9 16
ENSDART00000112457 None None 354 None 8
Genomic Location (Zv9):
Chromosome 10 (position 39781449)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 38471420
GRCz11 10 38415178
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GACACKTCCACGCACACCTGCCACAGGTCAACAGCTGAACAGGTGATGTA[C/A]AACTTTAATTTCACCCTGCCCWGAGACACGGATTGGGACAGATATGAAGA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4340
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110609 Nonsense 301 676 9 16
ENSDART00000112457 None None 354 None 8
Genomic Location (Zv9):
Chromosome 10 (position 39781471)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 38471442
GRCz11 10 38415200
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACAGGTCAACAGCTGAACAGGTGATGTACAACTTTAATTTCACCCTGCCC[A/T]GAGACACGGATTGGGACAGATATGAAGATCTTTTCCAGCGTCTCGACCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21788
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110609 Essential Splice Site 340 676 9 16
ENSDART00000112457 None None 354 None 8
Genomic Location (Zv9):
Chromosome 10 (position 39781591)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 38471562
GRCz11 10 38415320
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACACGTGGATCACACACTCTGTCATGGAGCTGGACAAGCCTGATGCGCTG[G/A]TGAGATTCTGGACTTTTCCTTTTAAAATTATTTCCCAAGTGTTGTTTAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27661
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110609 None None 676 None 16
ENSDART00000112457 Essential Splice Site 18 354 1 8
Genomic Location (Zv9):
Chromosome 10 (position 39783933)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 38473904
GRCz11 10 38417662
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCAAAGAAAACCATCAAATGCCTCTGATAAATCAAGAAACAAGCCAAAG[G/A]TAAAATATTTATCTATTTTTTAATTAATTAAAACTCTCTGTCCATCTGTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27662
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110609 Essential Splice Site 407 676 11 16
ENSDART00000112457 Essential Splice Site 85 354 3 8
Genomic Location (Zv9):
Chromosome 10 (position 39784460)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 38474431
GRCz11 10 38418189
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCGGAAAAAAATGGGCCGGAAATACACGAAAGCCCTGTCAGAGGAAACG[G/T]TGAGCACTCACCTTTAACTTTTAAAACAGCATCAAAAGCCTTAATCGAGC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27663
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110609 Nonsense 460 676 13 16
ENSDART00000112457 Nonsense 138 354 5 8
Genomic Location (Zv9):
Chromosome 10 (position 39788812)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 38478783
GRCz11 10 38422541
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCCTGATGCTTTAGGTGGTGTGACCAGCGGCTCTGAAGGTTATAGTAAC[A/T]GAGACAGCCTGCGTTTAGAAGAAGAGGTGCCCTTTGCAGGCCAGTTCTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21789
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110609 Nonsense 553 676 14 16
ENSDART00000112457 Nonsense 231 354 6 8
Genomic Location (Zv9):
Chromosome 10 (position 39789177)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 38479148
GRCz11 10 38422906
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAATCACACCACAACCGAGGATTCGTGCTCACCGGAGGAGCAGGAGACCT[C/T]GACCCAAAACCCTGCAGGAGCTTCTGGAAAGACTCAATCTGGAGGTGCTT
Associated Phenotype:
Not determined