Busch Lab

ZMP

nomo

Ensembl ID:
ENSDARG00000078592
ZFIN ID:
ZDB-GENE-040826-3
Human Orthologues:
NOMO1, NOMO2, NOMO3
Human Descriptions:
NODAL modulator 1 [Source:HGNC Symbol;Acc:30060]
NODAL modulator 2 [Source:HGNC Symbol;Acc:22652]
NODAL modulator 3 [Source:HGNC Symbol;Acc:25242]
Mouse Orthologue:
Nomo1
Mouse Description:
nodal modulator 1 Gene [Source:MGI Symbol;Acc:MGI:2385850]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa26716 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa33836 Nonsense Mutation detected in F1 DNA Not yet available
sa7035 Nonsense Mutation detected in F1 DNA Not yet available
sa10937 Nonsense Available for shipment Available now
sa15655 Essential Splice Site Available for shipment Available now
sa26715 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa26716
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112867 Essential Splice Site 85 1217 4 33
Genomic Location (Zv9):
Chromosome 6 (position 16699170)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 16590233
GRCz11 6 16717173
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGACTGTGCACCAATCAATGGTTACTTCATGATCCCACTGTATGACAAGG[T/C]ACAGTAACTCACGTACTGGAATGAATGGATTGACTGGGTGGATTATCAGG
Long Flanking Sequence:
CTGTTTAAAAATGATTAGTGGCTAGCTACGTTAGCGCTTGGCGTTCCGGAAGTGAATTGATAGACCGATCTGTATGTCATCTGCTGCCCTAAACAGTGATGCATTTAGGTTGTAGATCGCATAATCTGGTGATCCGTCTGTAGCAGGTTGCGTGACGGCTACCTAACCAAACTGTCAAGCATTGTCAGCAAAACACATGATTTGTCCAAGCTTGTGTAATTAGCTTTGGCTAACGTTAATCACTTTAAGATTCCATACAGTCTGACGACCAGTACAAGAAGCTCGTTGTAGTAATAGTGATGTTGTTGTTTCATTTCGTTATGTATGTGTTACTAAATAAGTATGATTTTAAAGGTAACACCGTTACATTGTCAAAAAATAAAATGTATTACTTATGTGTTCATTACAGATAAAGTTGTACACCAAGCAGGGTTCTCTGAAATATCAGACTGACTGTGCACCAATCAATGGTTACTTCATGATCCCACTGTATGACAAGG[T/C]ACAGTAACTCACGTACTGGAATGAATGGATTGACTGGGTGGATTATCAGGCTTTCAAGGTCATTTAAGAATGTCCTGCAACATGTAGTTTATACAGAATTATAAGCAATTGTTTTCTTATAGATCAAATAGATTTTACACAAAATAAAGAAGACTTTTCAGATTGTTTTTTAAAGACATAAGGTAATGTAGTCCAATCTGCATGTTTCCTGTTTTGTCTGGTTAAAGGAATTAGTAAACAAAGGCAAACTATCTTCTGTAAAAATATTATAGTTGGTTTTACATTCGACTGTCTTCTTAATATTGTATTTTCAGTAAAGTATTACTTGCATATTCTTTATAGGGAAATGATATTAGCAGCCAAAGACTAACAAAGTGCAACATTGTTCAGTCAATGAAATAGTGCTAATGTTGTTTTGAAGACATACTTGCATGCTTTTTCTGACCGAATATTCAGTTGCATGGTAAACAATATAGTGACAAGTTGTCACTGAACAAATA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5358
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112867 Essential Splice Site 322 1217 12 33
Genomic Location (Zv9):
Chromosome 6 (position 16686926)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 16577989
GRCz11 6 16704929
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAATCAGTTAARTCAGTTTTTTTAACCAGTTATTCCCATTTTGTTTCTCA[G/T]CCTGTTTTCCGGGTCATGGGATTCTCTGTGATGGGCAGAGTTCTGAATGG
Long Flanking Sequence:
AGTGAAAAAAGAGCCAAGAATTAAAAAATTTGTCATGAGCCTTATTAATAATTGCACATGTATTTTGGTCAAATTTCAGCCTGTTGTCAATGATGGTTCATAGGTAGCTATATTCTTCCCCAATCTTTGTGTTATTTATGACCACCCTTTGGAGAGAAGTGTAGAATTTTTTTTTTACCAAATTTAATGAGCATTTCTTTAGTTTTGACACATTCAGATCTAATAACCATATTTAACCAGATACCTTTTTTATGCGTATTCTGACAATCACTTGTATATAATATGAAAATAAAAACAAGAGAAAGTATACAGCCTTGTGGAGAGCCTGGAAAAATATTGATTATGCCTGATGAGGACTTATTATACCAATTTATAGACTAGGATTTATTGTTTTGGTTGTATACTTTACACATGTCGTGTTTAAAAAAAATAATTCAAAGAAAAGAAGCCAAATCAGTTAAATCAGTTTTTTTAACCAGTTATTCCCATTTTGTTTCTCA[G/T]CCTGTTTTCCGGGTCATGGGATTCTCTGTGATGGGCAGAGTTCTGAATGGCCCCGATGGAGAGGGAGTTGCAGATGCTGTAGTTACACTTAACAACCAGATTAAAGGTACCTGTGATAATACGCCTGAATAATATAATTAAACAACCTAAGTAGCCAACATTTCATGCTTAATTAACAAATGTATGCTAATTTAACACATTAACTTGATTTGCATTTATACTTTCTTGGTCTCTTTCACAGTGGAAACTAAAGAAGATGGTTCTTTCCGATTGGAGAATATGACCACAGGCACTTACACTATTAACACACACAAGGAGCTTATGTTCTTTGAACCAGTCACTGTGAAGATTGCTCCCAGCACGCCTCAGCTGCCAGATATCATCACTGCAGGGTGAGTATGCATACATTACATGAAATCCAGTGGAAGATGATATATAGAGATATAGAGATTTTTAATGCTGATGTCAATGTCTGATTTTAACATAGTTTAAAAGTCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33836
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112867 Nonsense 425 1217 14 33
Genomic Location (Zv9):
Chromosome 6 (position 16682787)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 16573850
GRCz11 6 16700790
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTAGTGTTTGTGGTCACATCTCCGTCACCCGTCTTCCAGAGACTGTTAAA[C/T]AGCTTGGACGCTACAAAGTTACACTTTCGGCTCAGAGGCAGGATCAGGGA
Long Flanking Sequence:
CTCTGCCAGTGAGACGAAAAGTTTCTTGAAGGGGGCGGGGCATGTCAGATAATAGGGAGTATTTTATTGGTCAAAATTTGATCAGAAACCGTATTAGGAAGTGATGTGAAAAATGTTTTATCTATTTAGATAAGAGTGACAAACTGCAAGCTTTGTATGTTTATATCTTCTACAAGCAAGTTTTGTCACTGTGTTATAGCACTCTAGCTTAAGTATATCTTTAAAACTAACATGCAATTATAAATAACAGAATAAAATGTTCCTATTAAATTAAAGTCTTCTGCATTATTATGCATTAATTATGAATTCAGTTTACTGTAACTTAACCTTTTGTAGTATTAAATCATTAAGGAAAATGAATGGAAACTGCTTTACAGACATACTCTAGTTTAAGTCTTCTGGTTTCATCAGATTGTTCTAAACCTTTTCCCAACTGTTTCATTTTTAGGTTTAGTGTTTGTGGTCACATCTCCGTCACCCGTCTTCCAGAGACTGTTAAA[C/T]AGCTTGGACGCTACAAAGTTACACTTTCGGCTCAGAGGCAGGATCAGGGATTTTTCCGGACTGTGGAAAGTGACAGTCATGGAGCGTTCTGTTTTCAGGTTAAACCAGGAGACTACAGTGTGCAGGTAAAGAGAAGTACAGTGCTCAGCCTAAATGAGTACACTCCATGTTGAAAATAATTATATTGATCCATTTCTCAGTGAATGAAGGTTATGTTTTTTGGGGGGCAAAACAGATGTACTAAATAGATATAAAAAAATAGTCACCAAACACTTTAGAAACAGAAAGAGAATTAATTTACATTAAAAATATAACCAGCCATCAAATATAAACCACTGAATAATTCTTCAAAAATGGCACATATAGCAGTGAAACATCAAATTTTATGAGGGAATAACTGAATCATTTATTAAAAATGAGATTAAAAAAATAAATAAGGGTTGCACAAGTTATAATGTTAGATTTCTACATTCAGCGTCATCAGCAACAATAGTAGTAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7035
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112867 Nonsense 635 1217 19 33
Genomic Location (Zv9):
Chromosome 6 (position 16677988)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 16569051
GRCz11 6 16695991
KASP Assay ID:
554-4969.1 (used for ordering genotyping assays)
KASP Sequence:
GTTTAGAGACTAAAGTATGTAACTTACTACTGTKTAATTAAAGGTGTYTA[T/G]AAAGTGACTCCACGCTCCTGTCACCAGTTTGAACAGGATTACTACACCTA
Long Flanking Sequence:
TATTATGATTTTGGACCAAGTCAGGCAACCTTTCAGCAGTACAGACTTTTAGTTTAATAAAGAGATTAACATCCTCTTGTTTTCACTAGTGTCTATCACCCAAGAAGAGTGGTGCTGGAAGCATAAGTCAGTGGAGATCGATGTACTTGACTCGTATGTAGAGGGAGTGGAGTTTCGACAAACTGGATACTTACTGCGCTGCTCACTGTCCCATGCTATTACACTGGTAAAACCTAAAACTTGATGAACATATTTTGCAGAATCACCAGTTACTTGTCTAATATTGTAAAGCAAATAATAATGCATTATTTGTACAAAACTTTAGGAATTTTTCCAAGACGGCAGTTTACCAGAGAATGTTGGCGTTTACAATCTGTCCAAAGGAGTCAATCGTTTCTGTCTGTCAAAGCCTGGTGAGCTCAGTAATTCCTTCAATTTAGTTAAGTTTAAGTTTAGAGACTAAAGTATGTAACTTACTACTGTTTAATTAAAGGTGTTTA[T/G]AAAGTGACTCCACGCTCCTGTCACCAGTTTGAACAGGATTACTACACCTACAACACGTATGTTATTTTAATAACATGAAAGCTTTTGCAGTATGTAGCATTATTAAAGAAATTCTAATCCACATGATTTGACTTTCTTTCTGTTCCATAGGTCTGCCCCAAGCATCTTAACTCTGACTGCTGTCAGACACCACATGACAGGACTTATAACCACTGATAAGATGTTGGATGTCACAGTCACCATCAAGTGAGTGAGAACATTGTTATATTTTTTTCTGTAAAAGAGTGAAGCATATATTTTGTCTTTTGTAGCTTTTATGTTTCTCCTCTAGTTAAACACTCACTTATGGCCCGTTTCCACTGAGTGGTATGGTGTGGTATGGTTCGGTACACTTTTATGGCCGTTTCCACTGTCAAAAGGTACCAAAAAGAGAACCGCACCGTACCACTTTTTGGTACTTTTACAAAAGGGTACCTAGTACAGCTGCACGACTCTGGCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10937
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112867 Nonsense 746 1217 21 33
Genomic Location (Zv9):
Chromosome 6 (position 16673823)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 16564886
GRCz11 6 16691826
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGCCCCCCTGTGGAAGAGAAACCAGAGGAACTTCGTGAGCCTTTTCACTA[T/G]GAATTCTCCTATTGGGCACGGTAGGATAATAGGAGAAAGCTTGTCATTGT
Long Flanking Sequence:
GGTCAGCTGAAGTATTTAAAACTTTCATGTGAAAGGCTTAAATTAACTGCGGCCGAACAGGGTCAACTTCCCTTTACAATGAAAAGCACTTTGGAACTATTCTCCAGCAAGTCCTATGTTGTGACTTCCTTATCCTGAGTAAAGTGCTTTGATGGATGTAATATCACTCTCACCATTGTGTGTTCATGCTTATGTTTGCATATGAGGAGTTCCGCCCTTTATAACATCAGCTAGTTTTGAATTTAGAAGCAAGTAAGATTTTTAATGAGAATCCTACTCATTAACATTGTAAATAACTTTGCTGGCTGTTATTTTGGCAGATCCTCTATTGAGAGTGAGCCTGCTTTGGTTCTGGGACCTCTACGCTCAAATGAGGAGCAGCGAAGGGAGCAGCAACTTCTGGAAATAGCTGCCCGTAAAAAAGAGAGAGGAGAAGCAGGCGATGAGAAGAGCCCCCCTGTGGAAGAGAAACCAGAGGAACTTCGTGAGCCTTTTCACTA[T/G]GAATTCTCCTATTGGGCACGGTAGGATAATAGGAGAAAGCTTGTCATTGTAGAATTGTACATCCAAAGAATTTGTCTCTTCTGTCAAGTGCAATTATTTTTGTGATCTTAACTTTATATATTGGTGGCATGTGCTGTTTTAGGGCTGGGGAGAAGATCACAGTCACACCTTCATCCAAAGAATTTCTGTTTTACCCTCCTGAAGTAGAGGCTACAATCACTGGTGGTGAGAGTGCAAACTTTGTTTTAAAGGAATGAATGAACTCAGTTGGCTTCAACAGTATAGTACCTTATTAGTTCCAGGTTGGATACTCTTTTGCCTTTAGCTCTGCCTTAATTATTTTTGGCCTAGATTTAAGTGTGCCACAGAATGGATGAGTGTGTATAGCTAGGCATAGTTGAATAATAAGACTTCACTACAATGAAGTTACATACTGTGAGCTTCAAACACACTTGTTCCCTCCTCCCTTATGTAACTCCTGTTTTAAACAAAACACCACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15655
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112867 Essential Splice Site 780 1217 22 33
Genomic Location (Zv9):
Chromosome 6 (position 16673597)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 16564660
GRCz11 6 16691600
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAAAGAATTTCTGTTTTACCCTCCTGAAGTAGAGGCTACAATCACTGGTG[G/A]TGAGAGTGCAAACTTTGTTTTAAAGGAATGAATGAACTCAGTTGGCTTCA
Long Flanking Sequence:
TCAGCTAGTTTTGAATTTAGAAGCAAGTAAGATTTTTAATGAGAATCCTACTCATTAACATTGTAAATAACTTTGCTGGCTGTTATTTTGGCAGATCCTCTATTGAGAGTGAGCCTGCTTTGGTTCTGGGACCTCTACGCTCAAATGAGGAGCAGCGAAGGGAGCAGCAACTTCTGGAAATAGCTGCCCGTAAAAAAGAGAGAGGAGAAGCAGGCGATGAGAAGAGCCCCCCTGTGGAAGAGAAACCAGAGGAACTTCGTGAGCCTTTTCACTATGAATTCTCCTATTGGGCACGGTAGGATAATAGGAGAAAGCTTGTCATTGTAGAATTGTACATCCAAAGAATTTGTCTCTTCTGTCAAGTGCAATTATTTTTGTGATCTTAACTTTATATATTGGTGGCATGTGCTGTTTTAGGGCTGGGGAGAAGATCACAGTCACACCTTCATCCAAAGAATTTCTGTTTTACCCTCCTGAAGTAGAGGCTACAATCACTGGTG[G/A]TGAGAGTGCAAACTTTGTTTTAAAGGAATGAATGAACTCAGTTGGCTTCAACAGTATAGTACCTTATTAGTTCCAGGTTGGATACTCTTTTGCCTTTAGCTCTGCCTTAATTATTTTTGGCCTAGATTTAAGTGTGCCACAGAATGGATGAGTGTGTATAGCTAGGCATAGTTGAATAATAAGACTTCACTACAATGAAGTTACATACTGTGAGCTTCAAACACACTTGTTCCCTCCTCCCTTATGTAACTCCTGTTTTAAACAAAACACCACTGAAGAACAGACAAAGCCATTTCTTTTTAAATTGAACATTTCATACTGAGATAACAGCATTAACAATAATTTAGCAATCATTGTTGATTATTGCAATAATGTTAACTGTAGTTGATCCTTGTACTATTCAAATGTACTACCCTTTTGTTATGTTGATGGTTGTTTTCGCTCCATTGACTTCCGTTATAATGACATTGTTTGATTGCAAAGCCATGACACCATATAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26715
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112867 Essential Splice Site 1032 1217 28 33
Genomic Location (Zv9):
Chromosome 6 (position 16666140)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 16557203
GRCz11 6 16684143
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGGAAATGATCACATAGAGAGAGCATTGCCACCACACAAGACAATTGAG[G/A]TGAGCGTTCACATTTATACAGTATTCATCTTAGTTTTGGTTTAAACCTCA
Long Flanking Sequence:
ATAAATGCTATTGTTCATTATTAGTTTACGTTTATAAATGTATTTATTGATGCAACCTTATTGTAAAGTGTTACCAAGCAAATAAAGGTAACTTGCACTTTTCAAATAGATATGAAACAGCACAACAATTTTTACCACTGAAAATAATAGTAATAATGTTTCTTTAGCAGCAGGACATAATTTTAGAATGATTTTTGAAGGATCATGCTGCTGAAGAAATGAAAATGATGTCTTTTAAACTGCATTCTTTTTATATTGTAATACTTTTTTACAATTGTACTGCATTTTGATCAATGAAAGTACAGCCTTGGTGAACAGAAAGTCTTCTTTGAAAGGAAAAAGCTACCGATCTAAAGCATTTTTTTGGTAGTCTACATGATTTTGAACAAATTTTGCCGTCTGATGTTTGTTGCCAGCCTGGTTGTAACTACAACATTCAGCTGAGAGGAGAGGGAAATGATCACATAGAGAGAGCATTGCCACCACACAAGACAATTGAG[G/A]TGAGCGTTCACATTTATACAGTATTCATCTTAGTTTTGGTTTAAACCTCATATTTAAAGTTTTTATTTATGTGTAAATATTTTTGGGATTCTTTTAGGTCGGCAACACCGATATTGATGGAATCAACATAATCGCCTTTAGACAGATCAATCAATTTGATCTGAGTGGAAATGTCATCACTTCCCCTGAGCATCTTCCCACTCTATGGGTAAGTGCAATACAACTTGAGGAGTTCAGATGCAAAAACCTCTAAGTGTCATCTAAAATGTTCTTCTAAACTGAGCATTTTTTACAAGCTCCTGTGTATAGGTTCAGTATTTTCACTGTTATGGCAAAGAATAATTTATTTTCATTGCCTTTAAAAGTGAAATAACTGAAAATGATTTAAGTGTAATATCTAAACATAAACATAAAGAGGCTGAGAAAAATGCTTATTCTAGACATGTCTCTCAGTGGAGCAAACTTCCGCTCAAACCTGCTCAGTCAGGACACTGGACCCC
Associated Phenotype:
Not determined