Busch Lab

ZMP

setd5

Ensembl ID:
ENSDARG00000078576
ZFIN ID:
ZDB-GENE-080523-1
Description:
SET domain containing 5 [Source:UniProtKB/TrEMBL;Acc:A5XCC2]
Human Orthologue:
SETD5
Human Description:
SET domain containing 5 [Source:HGNC Symbol;Acc:25566]
Mouse Orthologue:
Setd5
Mouse Description:
SET domain containing 5 Gene [Source:MGI Symbol;Acc:MGI:1920145]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa40686 Nonsense Mutation detected in F1 DNA Not yet available
sa40685 Nonsense Mutation detected in F1 DNA Not yet available
sa20695 Nonsense Available for shipment Available now
sa40684 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa40687
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113497 Essential Splice Site 163 1461 4 24
Genomic Location (Zv9):
Chromosome 6 (position 23506634)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 19762080
GRCz11 6 21822302
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGAAGAAAGGGGTCGATGGGCAACGCAGAAAAGCAGAGAATGTTTCAGG[T/G]AACCATCTTCACTCACTTAGATGAGAATTAATATATAGCAGTGCTATTCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26741
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113497 Nonsense 274 1461 7 24
Genomic Location (Zv9):
Chromosome 6 (position 23503573)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 19759019
GRCz11 6 21819241
KASP Assay ID:
2259-7520.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGAATTCGGCAATGGACGGACCAGTATGAGGAGGCTCTGGCTAACCAGTA[C/A]AGCGCTGATGTACAGACCCTCCTCGAACACTACTGTGCCAATGGCAACTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40686
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113497 Nonsense 448 1461 11 24
Genomic Location (Zv9):
Chromosome 6 (position 23499804)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 19755250
GRCz11 6 21815472
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGAAGTTTTGTATATTGAGTGTTTTCTTCTGAATCTCCCCACAGTAATTA[T/G]AAAGTGGATTGTGCATGTCACAAGGGCAATCAAGACTGTCCTGTACAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40685
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113497 Nonsense 480 1461 11 24
Genomic Location (Zv9):
Chromosome 6 (position 23499710)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 19755156
GRCz11 6 21815378
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TACAGAGACACAATCTCCGTCCCCTCGAACTGCTGTCCCCTCAGCCTTCA[C/T]AATTTGCCCTGCCTGGAGCAGAGACACGGAGGAGACGAGCGCGACGCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20695
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113497 Nonsense 494 1461 11 24
Genomic Location (Zv9):
Chromosome 6 (position 23499668)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 19755114
GRCz11 6 21815336
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCCTTCACAATTTGCCCTGCCTGGAGCAGAGACACGGAGGAGACGAGCG[C/T]GACGCAGAGAGCTGGAAGGGGACAAACTCGTAACGGGTATATCCGATGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40684
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113497 Nonsense 701 1461 14 24
Genomic Location (Zv9):
Chromosome 6 (position 23497549)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 19752995
GRCz11 6 21813217
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGTTGTGGTGGGTGGCGAAGAGGGTAGTGCAGCAGCAGGCCTCAAGGAA[C/T]AGGGCCAGGGAGAGGGAGCTCCAAACTGTGGTCATCTCCAAGATGGAGAA
Associated Phenotype:
Not determined