Busch Lab

ZMP

si:dkey-42o15.2

Ensembl ID:
ENSDARG00000078561
ZFIN ID:
ZDB-GENE-041111-75
Human Orthologue:
LRIG2
Human Description:
leucine-rich repeats and immunoglobulin-like domains 2 [Source:HGNC Symbol;Acc:20889]
Mouse Orthologue:
Lrig2
Mouse Description:
leucine-rich repeats and immunoglobulin-like domains 2 Gene [Source:MGI Symbol;Acc:MGI:2443718]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa18052 Nonsense Available for shipment Available now
sa38577 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa18052
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112700 Nonsense 110 1044 3 18
ENSDART00000141986 Nonsense 84 1018 3 18

The following transcripts of ENSDARG00000078561 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 47778955)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 47839607
GRCz11 6 47838366
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGTGGTGGCRGAGCAGCTGTTGCCRTATTCATCACTGGAAAGTCTAGACT[T/A]GAGCTCWAATTCTATATCMGAGCTTAAARCTGGATCATTCCCTCCCATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38577
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112700 Nonsense 468 1044 12 18
ENSDART00000141986 Nonsense 442 1018 12 18

The following transcripts of ENSDARG00000078561 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 47766097)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 47826749
GRCz11 6 47825508
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGATTTTCCTAAACCCCAGATCACAGCTCACCCAAAGACTGCTGTTGCGT[T/A]ACGTGGGACAAACGTCACTCTGAACTGCTCCGCCTTCAGCAGCAGTGACT
Associated Phenotype:
Not determined