Busch Lab

ZMP

si:ch211-264f5.2

Ensembl ID:
ENSDARG00000078547
ZFIN ID:
ZDB-GENE-080303-2
Description:
hypothetical protein LOC570749 [Source:RefSeq peptide;Acc:NP_001091723]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa36770 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa36770
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112211 Nonsense 15 409 1 7
Genomic Location (Zv9):
Chromosome 19 (position 6291869)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 5750724
GRCz11 19 5668976
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATATCCACATGGCTTTTCTGCTGCGTACCCTAGTGCTGCTTTTAGGAGTT[C/T]AAGGTAAGACAATCTTTAGGGTAATATATATATATACATATACATATATA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7874
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112211 Essential Splice Site 233 409 3 7
Genomic Location (Zv9):
Chromosome 19 (position 6287626)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 5746481
GRCz11 19 5664733
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTTCATATCACTGTCAATTCAAGGCAGATGTTTACWGATGGGAATACAAG[T/A]GAGTTTTGGTAATGGTTTMTTGCATRTATTGTGTAGTCAGAATGTATTTS
Associated Phenotype:
Not determined