Busch Lab

ZMP

SYDE2

Ensembl ID:
ENSDARG00000078537
Description:
synapse defective 1, Rho GTPase, homolog 2 (C. elegans) [Source:HGNC Symbol;Acc:25841]
Human Orthologue:
SYDE2
Human Description:
synapse defective 1, Rho GTPase, homolog 2 (C. elegans) [Source:HGNC Symbol;Acc:25841]
Mouse Orthologue:
Syde2
Mouse Description:
synapse defective 1, Rho GTPase, homolog 2 (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:3036264]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa37800 Nonsense Mutation detected in F1 DNA Not yet available
sa15758 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa37800
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111658 Nonsense 172 597 3 9
ENSDART00000113956 Nonsense 176 602 3 8
Genomic Location (Zv9):
Chromosome 23 (position 45048704)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 43850166
GRCz11 23 46019572
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCTAACCTGTCGCACATCGTTTCTTGACATGGACCACACCTTTAATATC[G/T]AGCTGGAGAACGCTCAGCATCTCAAACTTGTTGTCTTCAGCTGGGAGTCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15758
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111658 Nonsense 206 597 3 9
ENSDART00000113956 Nonsense 210 602 3 8
Genomic Location (Zv9):
Chromosome 23 (position 45048601)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 43850063
GRCz11 23 46019469
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCCRCGACGGAACCGRGTGTGCTGTCATGGGACCGWAGTTCTGCCGGGWT[T/A]ATTTSGAGTCAGTAAAACACACCAGCTGGCAGTGCGTCTGGAGCCRCGSG
Associated Phenotype:
Not determined