Busch Lab

ZMP

si:ch1073-436c4.1

Ensembl ID:
ENSDARG00000078529
ZFIN ID:
ZDB-GENE-081031-45
Description:
Novel protein similar to H.sapiens BAI1, brain-specific angiogenesis inhibitor 1 (BAI1) [Source:UniP
Human Orthologue:
BAI1
Human Description:
brain-specific angiogenesis inhibitor 1 [Source:HGNC Symbol;Acc:943]
Mouse Orthologue:
Bai1
Mouse Description:
brain-specific angiogenesis inhibitor 1 Gene [Source:MGI Symbol;Acc:MGI:1933736]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa23396 Essential Splice Site Available for shipment Available now
sa23397 Nonsense Available for shipment Available now
sa11442 Nonsense Available for shipment Available now
sa9373 Nonsense Mutation detected in F1 DNA Not yet available
sa7457 Missense Mutation detected in F1 DNA Not yet available
sa43190 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa23396
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109554 Essential Splice Site 294 1493 3 30
ENSDART00000133757 None None 283 None 6
ENSDART00000141359 None None 254 None 7
ENSDART00000143118 None None 269 None 5
ENSDART00000144323 None None 331 None 7
Genomic Location (Zv9):
Chromosome 19 (position 19983)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 102868
GRCz11 19 102958
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCGGCGTGACTCTGACGGCACCCTCATGGCTAACCAGGCCCCTCAGAAAG[G/A]TGTGTTTCTATGGCAACACTAAATCTGCTCCAGCCGGCAGCAGAGCAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23397
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109554 Nonsense 328 1493 4 30
ENSDART00000133757 None None 283 None 6
ENSDART00000141359 None None 254 None 7
ENSDART00000143118 None None 269 None 5
ENSDART00000144323 Nonsense 78 331 2 7
Genomic Location (Zv9):
Chromosome 19 (position 20167)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 102684
GRCz11 19 102774
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTGCGGTGAGGGCTGGCAGTCTCGCACCCGCTCCTGCATGAACTCCGCT[C/T]AGTGTATCGGCCCTTTAAGAGAGAACCGACCCTGCAACAACACCGCCGTC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4772
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109554 Nonsense 520 1493 8 30
ENSDART00000133757 None None 283 None 6
ENSDART00000141359 None None 254 None 7
ENSDART00000143118 None None 269 None 5
ENSDART00000144323 Nonsense 267 331 6 7
Genomic Location (Zv9):
Chromosome 19 (position 21100)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 101751
GRCz11 19 101841
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAGCGTCTGTAAGTGTCTCTACTGCTGTCTGCAGAACCACAYGAGATCTG[C/A]GGAGAGGAGAACTACGGCAGCATGGTGTGGAAGAAAACTCCGGCYGGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11442
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109554 Nonsense 576 1493 9 30
ENSDART00000133757 None None 283 None 6
ENSDART00000141359 None None 254 None 7
ENSDART00000143118 None None 269 None 5
ENSDART00000144323 Nonsense 323 331 7 7
Genomic Location (Zv9):
Chromosome 19 (position 21525)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 101326
GRCz11 19 101416
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTGTGGGTCTGGCCTTCTGGGAAAACCCCACTCACATCAAATGCGTCTCT[A/T]AAGACTTCCAGGAGATCCAGAGCTTGGTAAGAGAGASAGACASACACACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9373
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109554 Nonsense 907 1493 21 30
ENSDART00000133757 Nonsense 40 283 2 6
ENSDART00000141359 Nonsense 39 254 3 7
ENSDART00000143118 None None 269 None 5
ENSDART00000144323 None None 331 None 7
Genomic Location (Zv9):
Chromosome 19 (position 26208)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 96643
GRCz11 19 96733
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTGAGCTGAAGCTAATGTGGAGTGTTTCCCTCCTCAGGTACAWCCGCTCT[G/T]AGCGATCCRTKATCCTGWTCAACTTCTGCCTGWCCATCATCTKCTCCAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7457
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109554 Missense 1307 1493 27 30
ENSDART00000133757 None None 283 None 6
ENSDART00000141359 None None 254 None 7
ENSDART00000143118 Missense 67 269 1 5
ENSDART00000144323 None None 331 None 7
Genomic Location (Zv9):
Chromosome 19 (position 27950)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 94901
GRCz11 19 94991
KASP Assay ID:
554-4041.1 (used for ordering genotyping assays)
KASP Sequence:
GCAAGTACAACATCAGCACCGACCTTCCGCAGGCACGCCTCATGCACATT[A/T]GCGGWACCTACGCCGAGCCGCAAGCTGCCTACGCCACGCAGACGCTGCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43190
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109554 Essential Splice Site 1380 1493 27 30
ENSDART00000133757 None None 283 None 6
ENSDART00000141359 None None 254 None 7
ENSDART00000143118 Essential Splice Site 140 269 1 5
ENSDART00000144323 None None 331 None 7
Genomic Location (Zv9):
Chromosome 19 (position 28172)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 94679
GRCz11 19 94769
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGATGTCCAAGAGTGAGACCATCTCCACACTGTCCATGAGCTCCCTGGAG[G/T]TCAGCGAAGGGGTACGAGACTGCTCCACTGCTCAACCATCATTCTGTTCA
Associated Phenotype:
Not determined