Busch Lab

ZMP

DDR1

Ensembl ID:
ENSDARG00000078523
Description:
discoidin domain receptor tyrosine kinase 1 [Source:HGNC Symbol;Acc:2730]
Human Orthologue:
DDR1
Human Description:
discoidin domain receptor tyrosine kinase 1 [Source:HGNC Symbol;Acc:2730]
Mouse Orthologue:
Ddr1
Mouse Description:
discoidin domain receptor family, member 1 Gene [Source:MGI Symbol;Acc:MGI:99216]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7787
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115011 Nonsense 863 974 16 18
Genomic Location (Zv9):
Chromosome 16 (position 23638709)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 21748460
GRCz11 16 21552994
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTGGCATGAGCAGGAACCTCTATGCTGGCGATTACTACAGGATWCAGGGA[C/T]GAGCAGTGCTGCCCATTCGCTGGATGGCATGGGAGTGTATCCTCATGGTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7786
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115011 Nonsense 930 974 18 18
Genomic Location (Zv9):
Chromosome 16 (position 23637550)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 21747301
GRCz11 16 21552420
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTACATGAAGCTAACTCACTATCTGTCYGTTTGTCTCTTCATCAGGTGTA[T/A]CTGTCTCGCCCAGCYGTGTGTCCGCAGGGTTTGTATGAGCTCATGCTGAG
Associated Phenotype:
Not determined