Busch Lab

ZMP

acaca

Ensembl ID:
ENSDARG00000078512
ZFIN ID:
ZDB-GENE-060526-74
Description:
Novel protein similar to vertebrate acetyl-Coenzyme A carboxylase alpha (ACACA) [Source:UniProtKB/Tr
Human Orthologue:
ACACA
Human Description:
acetyl-CoA carboxylase alpha [Source:HGNC Symbol;Acc:84]
Mouse Orthologue:
Acaca
Mouse Description:
acetyl-Coenzyme A carboxylase alpha Gene [Source:MGI Symbol;Acc:MGI:108451]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa26588 Nonsense Mutation detected in F1 DNA Not yet available
sa33724 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa40568 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa20542 Essential Splice Site Available for shipment Available now
sa2214 Nonsense F2 line generated Not yet available

Mutation Details

Allele Name:
sa26588
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083079 Nonsense 734 2356 16 52
ENSDART00000146773 Nonsense 734 1190 16 25
Genomic Location (Zv9):
Chromosome 5 (position 57793745)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 55714344
GRCz11 5 56384561
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACGTATTTGTTAGAAATCATTTGAGTGTGTTTTATTTCATTCTCTAGGTA[T/A]CGCATCATTATCGGGAATAAGACGTGTGTGTTTGAAAAGGAGAACGACCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33724
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083079 Essential Splice Site 1351 2356 31 52
ENSDART00000146773 None None 1190 None 25
Genomic Location (Zv9):
Chromosome 5 (position 57769794)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 55690393
GRCz11 5 56360610
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACAGGATTTCAGAAAGCAAATCAACTGTGAGGTGGACCAGAGGTTCCATG[T/A]AAGTCATTGTGGAATGTTTTAGACATTGGTACTGTTCCACAACCTACTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40568
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083079 Essential Splice Site 1437 2356 33 52
ENSDART00000146773 None None 1190 None 25
Genomic Location (Zv9):
Chromosome 5 (position 57764443)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 55685042
GRCz11 5 56355259
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCGCTTCTTTGTGCGGGCAATCATCCGTCACTCAGATTTGGTCACCAAG[G/T]TAGGAGAGTCTCTGCTGTCTGAGATCACCTTCAAAAATCTGATTAGGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20542
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083079 Essential Splice Site 1986 2356 44 52
ENSDART00000146773 None None 1190 None 25
Genomic Location (Zv9):
Chromosome 5 (position 57734291)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 55654890
GRCz11 5 56325107
KASP Assay ID:
2259-6585.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGGAGATCATGCAGCCATGGGCACAGAGTGTTGTCGTAGGACGGGCCAG[G/A]TAAGCACTGATTGATGCATACAACAGACACAAAAAGTATTTGAACTCAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2214
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083079 Nonsense 2188 2356 49 52
ENSDART00000146773 None None 1190 None 25
Genomic Location (Zv9):
Chromosome 5 (position 57726582)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 55647181
GRCz11 5 56317398
KASP Assay ID:
554-2696.1 (used for ordering genotyping assays)
KASP Sequence:
GAGCTGGAGAGTAAACTAAAAGAGAGAGAAGAGTTCCTGCTGCCCATATA[T/A]CATCAAGTAGCTGTTCAGTTYGCTGACCTTCATGACACACCGGGCCGCAT
Associated Phenotype:
Not determined