Busch Lab

ZMP

socs4

Ensembl ID:
ENSDARG00000078509
ZFIN ID:
ZDB-GENE-070720-4
Description:
suppressor of cytokine signaling 4 [Source:RefSeq peptide;Acc:NP_001104695]
Human Orthologue:
SOCS4
Human Description:
suppressor of cytokine signaling 4 [Source:HGNC Symbol;Acc:19392]
Mouse Orthologue:
Socs4
Mouse Description:
suppressor of cytokine signaling 4 Gene [Source:MGI Symbol;Acc:MGI:1914546]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa13210 Nonsense Available for shipment Available now
sa2894 Nonsense F2 line generated Not yet available

Mutation Details

Allele Name:
sa13210
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124426 Nonsense 289 423 2 2
Genomic Location (Zv9):
Chromosome 17 (position 15038917)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 15189745
GRCz11 17 15197678
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCAACAACAGCCCTTGTTATTGGGGYGTTCTGGATCGTTTCGAGGCTGAG[C/T]AGCTTTTGGAAGGGCAGCCAGAGGGGACTTTTCTGCTCAGAGACTCTGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2894
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124426 Nonsense 394 423 2 2
Genomic Location (Zv9):
Chromosome 17 (position 15038600)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 15189428
GRCz11 17 15197361
KASP Assay ID:
554-2484.1 (used for ordering genotyping assays)
KASP Sequence:
TTCWCTCTGCAGCACTTGTGCAGGGCGGTTATCTGTAGCTGCACCACATA[T/G]CAGGGGATTGAAGCGCTACCTTTACCCTACACTTTGAGACACTTTCTTAG
Associated Phenotype:
Not determined