Busch Lab

ZMP

snpha

Ensembl ID:
ENSDARG00000078485
ZFIN ID:
ZDB-GENE-081104-227
Description:
Novel protein similar to vetebrate SNPH, Syntaphilin (SNPH) [Source:UniProtKB/TrEMBL;Acc:A9C498]
Human Orthologue:
SNPH
Human Description:
syntaphilin [Source:HGNC Symbol;Acc:15931]
Mouse Orthologue:
Snph
Mouse Description:
syntaphilin Gene [Source:MGI Symbol;Acc:MGI:2139270]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa9501 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9501
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109012 Nonsense 223 470 4 5
ENSDART00000138746 Nonsense 225 253 4 4
Genomic Location (Zv9):
Chromosome 8 (position 51415943)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 49166330
GRCz11 8 49155099
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTGATACGTCCYCTGGTGCTACAGATCGCAATGGAAAYGTGCGTACTGAT[C/T]GATACATTCCCCCCAACAGAGGGGCGATGACRCTACCAAGAGGCGATGGG
Associated Phenotype:
Not determined