Busch Lab

ZMP

wu:fc07e02

Ensembl ID:
ENSDARG00000078473
ZFIN IDs:
ZDB-GENE-030131-2424, ZDB-GENE-040912-175
Description:
nuclear ubiquitous casein and cyclin-dependent kinases substrate [Source:RefSeq peptide;Acc:NP_0010
Human Orthologue:
NUCKS1
Human Description:
nuclear casein kinase and cyclin-dependent kinase substrate 1 [Source:HGNC Symbol;Acc:29923]
Mouse Orthologue:
Nucks1
Mouse Description:
nuclear casein kinase and cyclin-dependent kinase substrate 1 Gene [Source:MGI Symbol;Acc:MGI:193481

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa41902 Nonsense Mutation detected in F1 DNA Not yet available
sa45440 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa41902
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102858 Nonsense 173 305 6 8
Genomic Location (Zv9):
Chromosome 11 (position 39780319)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 38278575
GRCz11 11 38545780
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGGCAGTGAGGATGAGGAGAAGGATGAGGAAGAACAGGCCTTCCTGGAC[C/T]GTAAGTGTCATCATCATTATCTTTTATAAAATTCCTCATTGTTGAAGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45440
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102858 Essential Splice Site 226 305 7 8
Genomic Location (Zv9):
Chromosome 11 (position 39777125)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 38275381
GRCz11 11 38542586
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGGAGAAGAAGGAGAAGAAATCCCCCAAACCCCGGCTAAAGGCTACAGG[T/C]AAGCAATAGCACTCTTGAATATTTAGGATTTGGGAAAATAAAGGGCAGAT
Associated Phenotype:
Not determined