Busch Lab

ZMP

zgc:162225

Ensembl ID:
ENSDARG00000078472
ZFIN ID:
ZDB-GENE-070410-42
Description:
heat shock factor protein 5 [Source:RefSeq peptide;Acc:NP_001082945]
Human Orthologue:
HSF5
Human Description:
heat shock transcription factor family member 5 [Source:HGNC Symbol;Acc:26862]
Mouse Orthologue:
Hsf5
Mouse Description:
heat shock transcription factor family member 5 Gene [Source:MGI Symbol;Acc:MGI:2685585]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa45184 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa45184
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113934 Nonsense 171 416 3 6
Genomic Location (Zv9):
Chromosome 5 (position 3094021)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150672.1 58624
GRCz11 5 3107948
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCAGGTTCTGCCCAGCTCTCAGGAGGTGCAGCCCATCAGCAGCCAGAGTA[T/A]GAGCAAAGCCCAATGACTGGCCACTCCTGGATCTTTCCCTGCGCTGATGC
Associated Phenotype:
Not determined