Busch Lab

ZMP

si:dkey-81j5.3

Ensembl ID:
ENSDARG00000078468
ZFIN ID:
ZDB-GENE-081104-439
Description:
Novel protein similar to vertebrate dipeptidyl-peptidase 4 (CD26, adenosine deaminase complexing pro
Human Orthologues:
DPP4, FAP
Human Descriptions:
dipeptidyl-peptidase 4 [Source:HGNC Symbol;Acc:3009]
fibroblast activation protein, alpha [Source:HGNC Symbol;Acc:3590]
Mouse Orthologues:
Dpp4, Fap
Mouse Descriptions:
dipeptidylpeptidase 4 Gene [Source:MGI Symbol;Acc:MGI:94919]
fibroblast activation protein Gene [Source:MGI Symbol;Acc:MGI:109608]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa21604 Essential Splice Site Available for shipment Available now
sa15641 Essential Splice Site Available for shipment Available now
sa1475 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa21604
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109832 Essential Splice Site 255 753 8 25
ENSDART00000132896 Essential Splice Site 251 750 9 26
Genomic Location (Zv9):
Chromosome 9 (position 52584327)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 51706639
GRCz11 9 51238062
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTATGGAAATGACCAGTACCCAGTCACAGTATTCGTCCCCTACCCGAAAG[T/C]AAGTAAACATCCCAGCATTTCAGAATGTCTAGTGTCACTACTGCCTGAGC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27491
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109832 Essential Splice Site 331 753 10 25
ENSDART00000132896 Essential Splice Site 327 750 11 26
Genomic Location (Zv9):
Chromosome 9 (position 52588482)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 51710794
GRCz11 9 51242217
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACTCCTGCAGATCTACGACTACGATGGCACCAAGTGGAAAGAAAGCACGG[T/A]GAAGTAGATTGTTAGCTAAATACTTTGCAGAAATAGCAAAAAGCATCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15641
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109832 Essential Splice Site 536 753 19 25
ENSDART00000132896 Essential Splice Site 532 750 20 26
Genomic Location (Zv9):
Chromosome 9 (position 52601168)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 51723480
GRCz11 9 51254903
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TATTACANATTATTTCTCTGCTATAGCTGTGTTTTTCCACTGTCACATTAA[A/G]GGTATGGTGGTCCAGCCAGCCAGAACATAGACTATGTGTTTCGCTTGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1475
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109832 Essential Splice Site 696 753 23 25
ENSDART00000132896 Essential Splice Site 692 750 24 26
Genomic Location (Zv9):
Chromosome 9 (position 52604954)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 51727266
GRCz11 9 51258689
KASP Assay ID:
554-1400.1 (used for ordering genotyping assays)
KASP Sequence:
AAAAAAYTTCAAGTCGGTGCAGTACTTGCTGGTGCACGGCACTGCAGACG[G/A]TAACTAATTAAATACACATCTGAGAGCAGACAAAACAGCAATGTACAGTA
Associated Phenotype:
Not determined