Busch Lab

ZMP

si:dkey-254e1.2

Ensembl ID:
ENSDARG00000078452
ZFIN ID:
ZDB-GENE-091118-52
Human Orthologue:
HMOX2
Human Description:
heme oxygenase (decycling) 2 [Source:HGNC Symbol;Acc:5014]
Mouse Orthologue:
Hmox2
Mouse Description:
heme oxygenase (decycling) 2 Gene [Source:MGI Symbol;Acc:MGI:109373]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa10015 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8112
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112800 Nonsense 121 318 3 5
ENSDART00000140123 Nonsense 121 287 5 6
Genomic Location (Zv9):
Chromosome 3 (position 12990748)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 12022973
GRCz11 3 11963173
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CATGAGCTGCACCGGCGGGAYGCTCTGGCTCAAGACCTGCAGTTTTTCTA[T/A]GGCTCAGACTGGCAGACCCAGATCAGCATTTCTCCCGCCACRCAGCGATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10015
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112800 Nonsense 294 318 5 5
ENSDART00000140123 None None 287 None 6
Genomic Location (Zv9):
Chromosome 3 (position 12986244)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 12018469
GRCz11 3 11958669
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTGCCAGTGGYGGGKCATCWTATGTTTGTCAAATAGCCAAGACTGTGCTT[A/T]AAAATCCCTCCGGTCAAGTCCTATTGGCTGCCTGGATCGCTGCTCTCGCC
Associated Phenotype:
Not determined