Busch Lab

ZMP

LOC100001171

Ensembl ID:
ENSDARG00000078448
Human Orthologue:
GPR137B
Human Description:
G protein-coupled receptor 137B [Source:HGNC Symbol;Acc:11862]
Mouse Orthologue:
Gpr137b
Mouse Description:
G protein-coupled receptor 137B Gene [Source:MGI Symbol;Acc:MGI:1891463]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa35600 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28207
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031858 Nonsense 135 373 3 7
Genomic Location (Zv9):
Chromosome 13 (position 51135280)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 49846377
GRCz11 13 50159620
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGAATGAGTGTGTTATACCAGTGTTGTTTTGTGTCAGGCTGCCGCTGTA[C/A]CTGCTGTTCCTGTCCATCAGTCTGCTGTTCCTGCTGGTCAATCTGACCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35600
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031858 Essential Splice Site 206 373 4 7
Genomic Location (Zv9):
Chromosome 13 (position 51137909)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 49849006
GRCz11 13 50162249
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAACTCTGTCTATTTTATTTATTGTGACTGGACTATATGCTGTTGTGTGC[A/T]GGGCACTTCTGTGTGTCAGGTGACATTGATTGGGGTGACGGTGGTCCTGC
Associated Phenotype:
Not determined