Busch Lab

ZMP

si:rp71-15d4.2

Ensembl ID:
ENSDARG00000078434
ZFIN ID:
ZDB-GENE-081104-484
Description:
zinc finger protein 692 [Source:RefSeq peptide;Acc:NP_001116748]
Human Orthologue:
ZNF692
Human Description:
zinc finger protein 692 [Source:HGNC Symbol;Acc:26049]
Mouse Orthologue:
Zfp692-ps
Mouse Description:
zinc finger protein 692, pseudogene Pseudogene [Source:MGI Symbol;Acc:MGI:2144276]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa18471 Nonsense Available for shipment Available now
sa1641 Nonsense F2 line generated Not yet available
sa41179 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa18471
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113340 Nonsense 192 503 3 11
ENSDART00000134124 Nonsense 192 503 4 12

The following transcripts of ENSDARG00000078434 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 20523121)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 19953018
GRCz11 8 19985103
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGAAGGAACCARTCACAGATACAGAAAGACAAGAAATGATGACTAGATTA[A/T]AAACCAGACAGCAACAGAGAGAAGATGCTGGCAMTRACACAAATAAAATG
Long Flanking Sequence:
TTCTTGCTGTGAAGCAATAGTACTACCCACTGAGCCACCGTGTCACCTGCTTTAAATCTTTGTGCACTTTTTTTTATTATTGTTTTTATCATTGATAATCTGTGGCATTAAATCAATTGAACTTAGGTGATGGGAAAGAAGAGACTGTATCAACTACAAAGGAGTCTTTGCAGGAACTCATCTTGATGGTCCACAACCATGGACAGACGTGTCCCCTTCCTCCTGTCCTGCAGTGTAGGCCTGTTCAAAAAACAAAACTATCAACACGCAGTCAGAGTGGAAGAATAGAGGCTGCTACTGAGCCCAAGAAATTAGCAGAAGCGGATGAGTGTTTTAAATATACATGTGAAGATGGACATCATTTTATGTGGTGTCCTTTTAACCTGGAGAAGGTACTGATTTCTAAAAATGAAGGAGATAAAATTACATCCGAACAAGGCAAGAGACAGATGAAGGAACCAGTCACAGATACAGAAAGACAAGAAATGATGACTAGATTA[A/T]AAACCAGACAGCAACAGAGAGAAGATGCTGGCACTAACACAAATAAAATGCTTGGACAAAATAAAAATGCAGGTGAATGCTTTTTCTTTAATAAATAATAATTAATAATAATAATATTTTTTTTTTCAAGGACTAACTATACACTGTAAAAAATTTGACCTTAAATTCACAGTAAATTACTGGCTAATAATTGCATTACTTTCACAGTAAATTACTGTATGTAAATTCACAGTAAATTATTGTGAGGTAGTTCACAGTAATTTACTGTGGTTTTGTCACATTAAATTATTGTGAAATTACAACCATATATTGTAACTTTACAGTAGATAATAAAGTCCGTTACTGTGATTTCACAGTATTATCTTGTAGAATTAACTATATTTTACTGTGAATTTGCAATATGATTACTGTGATTTAGCAGTAGGTTGCAGTTTAAATACCTGATTTAACTGTAAAGTTACAGTTATATCCCGGATTACTGTAATTTAACAGTTTGGTGC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2465
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113340 Essential Splice Site 216 503 4 11
ENSDART00000134124 Essential Splice Site 216 503 5 12

The following transcripts of ENSDARG00000078434 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 20528446)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 19958343
GRCz11 8 19990428
KASP Assay ID:
554-3446.1 (used for ordering genotyping assays)
KASP Sequence:
GTAACTTGTTGTGAAAACCTGGAAATTTTTTACAGTGTAACCTTGTTTGC[A/T]GATGTTACAGAGACTCTTGAAGCACAGGACARAAATGATCTGGCATCTGA
Long Flanking Sequence:
ACATTTACCCTGACATTGAAATAATTTTTGGCTGTTTAACAGTCTTTGGTTTCATTAATTAATTACTTTTTATTCCAGTTTATTATGTTTTGGCTAAGCACACAGATATGTTCATTAAATATTAGTTCATATTCTATGTTAACTGTAAAAAAAATTAAATAATGGTGCAGTACAACCAAAAAGATGTTGGTAACCAAATCGTTTTGGGGGCTATAACATTCTGTTATTATCTGTTAAAAGTAATTTGTATTAATTTCTACGTTGAATTAAAAAAAGGTTTGAATTTCTATAACTAACGTGCAAAATATATAGTCTTTTTCACAGTAATTTGCTGTAATCATGCTACCTGCCGTAATTTCACAATAAAATTATGAATACAACATATTACTGTGAATTTTTCAGTTAAATACTGTGAAGGGATACTAATGTAATTTACTGTGAAAAATTACAGTAACTTGTTGTGAAAACCTGGAAATTTTTTACAGTGTAACCTTGTTTGC[A/T]GATGTTACAGAGACTCTTGAAGCACAGGACAAAAATGATCTGGCATCTGATTTTTCTTATTCAGAGCATGGGTACATATTGGGTTTGGTTGTTCTGCTGTGTTTTACTGGAAAAAATATTCTTTGATTTCTATTTATATCTTTAATCATGTTTTTTTTTTTTTCTGATTGCCAGATCTCCAGCAGACAGTGATGAGATGACTGTAGATGTTCCTGTCAGCCATACTGATAGGTATTCACTTTATTCATATACAATGATACATGAAAAGACTGAAAAATACAGCTAAATACTTTTCTCTAGCTATGAAGAATTTGCAGTGCTGAATTTAACCAACAGAGGGACCCAAAGTAGTGCAGATCATACTGAGAAACTTAGCGTCAGCAAAAAGGCGGGAATACTTCAAAGTAACAGGTGATACTTTTCTAACAGAAGATGTGCTTCATATTTTCAAATGATTTGGTTGTAGTTAAGAGTTCTTTTTCTCCTCAGTTCACAGTCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1641
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113340 Nonsense 465 503 11 11
ENSDART00000134124 Nonsense 465 503 12 12

The following transcripts of ENSDARG00000078434 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 20535669)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 19965566
GRCz11 8 19997651
KASP Assay ID:
554-1581.1 (used for ordering genotyping assays)
KASP Sequence:
GAAAAGAGAGAYAATGTTACGGCTCACCGTAGCAAGAGTCACCCAGACTA[T/G]AATACAGGCACTCTGGAAAGATCTCTTCCCCTTCCTCCCTCTGACCCACT
Long Flanking Sequence:
TAATAGAGATGAGTTGATGTTTTTTTTCCTGCTGTTCCTGTTAATACGTTTTTCTCCCTGTGCTTCTTTATGTCTGTGAGATCAGCGAGACTATATCTGTGAGTTCTGTGCTCGGGCGTTTCGAACCAGCAGTAACCTGATCATCCACCGCAGGATACACACCGGAGAGAAGCCGCTGCAGTATGAGTTTCACCACATATTCATTAGGCCTTTTGTTTATGCCAAAGGATTGTGTAACTCCCAACTCATTTTTTAACAAACTTTCAATCAATATTGAACACAACTAGATTGCTCAAGGGTCTTTTATGACAGCTTTTTCTATCTTTCCTTTTGAGGTGTGAAGTGTGTGGCTTCACCTGTCGACAGAAAGCCTCTCTGAATTGGCACATGCGGAAACACAATGCTGAGAGCACCTACCAGTTCCCTTGTGAGATCTGCGGCCGTCGCTTTGAAAAGAGAGACAATGTTACGGCTCACCGTAGCAAGAGTCACCCAGACTA[T/G]AATACAGGCACTCTGGAAAGATCTCTTCCCCTTCCTCCCTCTGACCCACTCCTGCATCCCTCGAGGCACCGCGGATCTTCCCCTTCTGTTTCCAAGAATCAACCCACTGCAGAATAAGAGTTGTGACAACAGTTTGAACACTCTTGACCTCAAGCAATCTCTAATGTGGGATTGGTTGGTAAACAAAATCTCCATGCGGTGCCTTAATAATGTTGTTAGTTCTTATTTTGTTTTTGTTTTTTAGATTTTTTTCAGAGACCGTGAATAGACCATCAGTATACACAGGTCAGTATTTGACAAATTGAGTACGCTTACATGGACACCAATAATCTGATCTGAATACTATTAAGACAATACTCTGATTGATAGTCTACCATGTAAACAGCGAGTTTTGATTAATTTAATAAAATTAAGACATATGCTGATTTTAGCCGCATTATTGAAGTGCAGTACAGACATGTAAACTATGTCAAACTATTTTCATCATGTAGTTTTATCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41179
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113340 Nonsense 499 503 11 11
ENSDART00000134124 Nonsense 499 503 12 12

The following transcripts of ENSDARG00000078434 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 20535769)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 19965666
GRCz11 8 19997751
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCTGCATCCCTCGAGGCACCGCGGATCTTCCCCTTCTGTTTCCAAGAAT[C/T]AACCCACTGCAGAATAAGAGTTGTGACAACAGTTTGAACACTCTTGACCT
Long Flanking Sequence:
GAGTTCTGTGCTCGGGCGTTTCGAACCAGCAGTAACCTGATCATCCACCGCAGGATACACACCGGAGAGAAGCCGCTGCAGTATGAGTTTCACCACATATTCATTAGGCCTTTTGTTTATGCCAAAGGATTGTGTAACTCCCAACTCATTTTTTAACAAACTTTCAATCAATATTGAACACAACTAGATTGCTCAAGGGTCTTTTATGACAGCTTTTTCTATCTTTCCTTTTGAGGTGTGAAGTGTGTGGCTTCACCTGTCGACAGAAAGCCTCTCTGAATTGGCACATGCGGAAACACAATGCTGAGAGCACCTACCAGTTCCCTTGTGAGATCTGCGGCCGTCGCTTTGAAAAGAGAGACAATGTTACGGCTCACCGTAGCAAGAGTCACCCAGACTATAATACAGGCACTCTGGAAAGATCTCTTCCCCTTCCTCCCTCTGACCCACTCCTGCATCCCTCGAGGCACCGCGGATCTTCCCCTTCTGTTTCCAAGAAT[C/T]AACCCACTGCAGAATAAGAGTTGTGACAACAGTTTGAACACTCTTGACCTCAAGCAATCTCTAATGTGGGATTGGTTGGTAAACAAAATCTCCATGCGGTGCCTTAATAATGTTGTTAGTTCTTATTTTGTTTTTGTTTTTTAGATTTTTTTCAGAGACCGTGAATAGACCATCAGTATACACAGGTCAGTATTTGACAAATTGAGTACGCTTACATGGACACCAATAATCTGATCTGAATACTATTAAGACAATACTCTGATTGATAGTCTACCATGTAAACAGCGAGTTTTGATTAATTTAATAAAATTAAGACATATGCTGATTTTAGCCGCATTATTGAAGTGCAGTACAGACATGTAAACTATGTCAAACTATTTTCATCATGTAGTTTTATCGCATTTTGTGACAGGATAGTCTATACACACACACGACTGTTTGACACTATTCTCTGCACCTACCAAGTCAGTGAAGGACCACAGACATCTGCATCGTGAAAT
Associated Phenotype:
Not determined