Busch Lab

ZMP

tiam1

Ensembl ID:
ENSDARG00000078430
ZFIN ID:
ZDB-GENE-080325-1
Human Orthologue:
TIAM1
Human Description:
T-cell lymphoma invasion and metastasis 1 [Source:HGNC Symbol;Acc:11805]
Mouse Orthologue:
Tiam1
Mouse Description:
T-cell lymphoma invasion and metastasis 1 Gene [Source:MGI Symbol;Acc:MGI:103306]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa41663 Nonsense Mutation detected in F1 DNA Not yet available
sa21737 Nonsense Available for shipment Available now
sa34907 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa1492 Nonsense Available for shipment Available now
sa16005 Nonsense Available for shipment Available now
sa11659 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41663
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110751 Nonsense 177 1621 1 25
ENSDART00000131640 None None 260 None 6
ENSDART00000143978 Nonsense 177 1572 2 25

The following transcripts of ENSDARG00000078430 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 26259622)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 25663479
GRCz11 10 25625192
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCGCTCCAAATCTGCTGACATGTGGAGAGATGATTCCATGGAGTTCTCGT[T/A]GTCAGACCTTAGCCAAGAACATCTGACAAGCACAGAGGAAATTATAGGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21737
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110751 Nonsense 290 1621 1 25
ENSDART00000131640 None None 260 None 6
ENSDART00000143978 Nonsense 290 1572 2 25

The following transcripts of ENSDARG00000078430 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 26259283)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 25663140
GRCz11 10 25624853
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGAGCGTACACTCTTCCCTGTCGTCGCTCTCACTGCCTGTCAGAAGGGT[T/A]GTCCAATCACCAGACTACCATCTGCTCACGTATGCAGGGACGACGAGCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34907
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110751 Essential Splice Site 858 1621 11 25
ENSDART00000131640 None None 260 None 6
ENSDART00000143978 Essential Splice Site 809 1572 11 25

The following transcripts of ENSDARG00000078430 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 26241702)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 25645559
GRCz11 10 25607272
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATATCTTAGTTCCTTTATTAAGTCATTGACTTATGTTTTCTCTCGTCTCC[A/T]GGTTTCTCTGTGGCAGTGGTAGAGGAGGATGGAGGCCAGCAGCTTCATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1492
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110751 Nonsense 1154 1621 17 25
ENSDART00000131640 Nonsense 177 260 5 6
ENSDART00000143978 Nonsense 1105 1572 17 25

The following transcripts of ENSDARG00000078430 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 26217101)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 25620958
GRCz11 10 25582671
KASP Assay ID:
554-1417.1 (used for ordering genotyping assays)
KASP Sequence:
TTAAACCTTCAGAAAGTTCTGTTTTCTCTTGGYGGATCTTTCCTCTACTA[T/A]GCGGACCGTTTTAAGATCTACAGTGCATTTTGTGCMAGTCACACAAAAGT
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27615
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110751 Essential Splice Site 1314 1621 21 25
ENSDART00000131640 None None 260 None 6
ENSDART00000143978 Essential Splice Site 1265 1572 21 25

The following transcripts of ENSDARG00000078430 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 26214163)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 25618020
GRCz11 10 25579733
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTGGTTTTGTGTGTTGCTTGAATGTTTTTTTTTTTTTTTCTCTTCTTCA[G/A]TTTTCAGAACAGCGGTTGTTTTTGTGTGTAAGGACTGCTCCAAGCAAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16005
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110751 Nonsense 1414 1621 24 25
ENSDART00000131640 None None 260 None 6
ENSDART00000143978 Nonsense 1365 1572 24 25

The following transcripts of ENSDARG00000078430 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 26209530)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 25613387
GRCz11 10 25575100
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAGAGAGTAAAAAAGACTTCTTAAAGACTGTYCATTCCATCCTGAGGGAC[A/T]AACAACGGCGCCAGCTTATGAAGACCGAAAGTTTACCTCCAAATCAGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11659
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110751 Nonsense 1575 1621 25 25
ENSDART00000131640 None None 260 None 6
ENSDART00000143978 Nonsense 1526 1572 25 25

The following transcripts of ENSDARG00000078430 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 26208756)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 25612613
GRCz11 10 25574326
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGTGGAAGGAGATGAAGACAAGGGTCTYAACGGGCTCTCCGAGGACAAAT[C/A]GAAGAAATCYCACGCCCCCTTGAAACTGACCCTTCTGAGAAAGCAATGCG
Associated Phenotype:
Not determined