Busch Lab

ZMP

ENSDARG00000078427

Ensembl ID:
ENSDARG00000078427
Mouse Orthologues:
Gm10891, Gm10893, Gm10909, Gm13896, Gm13926, Gm13979, Gm16591, Gm16837, Gm16940, Gm17015, Gm6037, Gm6683
Mouse Descriptions:
predicted gene 10891 Gene [Source:MGI Symbol;Acc:MGI:3800299]
predicted gene 10893 Gene [Source:MGI Symbol;Acc:MGI:3704436]
predicted gene 10909 Gene [Source:MGI Symbol;Acc:MGI:3642826]
predicted gene 13896 Gene [Source:MGI Symbol;Acc:MGI:3702130]
predicted gene 13926 Gene [Source:MGI Symbol;Acc:MGI:3702147]
predicted gene 13979 Gene [Source:MGI Symbol;Acc:MGI:3651288]
predicted gene 17015 Gene [Source:MGI Symbol;Acc:MGI:4819748]
predicted gene 6037 Gene [Source:MGI Symbol;Acc:MGI:3649172]
predicted gene 6683 Gene [Source:MGI Symbol;Acc:MGI:3704133]
predicted gene, 16591 Gene [Source:MGI Symbol;Acc:MGI:4439369]
predicted gene, 16837 Gene [Source:MGI Symbol;Acc:MGI:4439761]
predicted gene, 16940 Gene [Source:MGI Symbol;Acc:MGI:4439864]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa39878 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa30824 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa25116 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa39878
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110378 Essential Splice Site 17 113 2 2
ENSDART00000110378 Essential Splice Site 17 113 2 2
Genomic Location (Zv9):
Chromosome 2 (position 36214973)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 36511683
GRCz11 2 36494140
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTCATAATAATTCATGTTAATGATATCTACTTTTTCTGTTATACTTTCC[A/G]GTGTGCAGAGGACAAGACAGAGTGGAACAGGTTGAAGGAGAAATGAGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30824
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110378 Essential Splice Site 17 113 2 2
ENSDART00000110378 Essential Splice Site 17 113 2 2
Genomic Location (Zv9):
Chromosome 2 (position 36214973)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 36511683
GRCz11 2 36494140
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTCATAATAATTCATGTTAATGATATCTACTTTTTCTGTTATACTTTCC[A/G]GTGTGCAGAGGACAAGACAGAGTGGAACAGGTTGAAGGAGAAATGAGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25116
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110378 Nonsense 21 113 2 2
Genomic Location (Zv9):
Chromosome 2 (position 36214960)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 36511670
GRCz11 2 36494127
KASP Assay ID:
554-7837.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATGTTAATGATATCTACTTTTTCTGTTATACTTTCCAGTGTGCAGAGGA[C/T]AAGACAGAGTGGAACAGGTTGAAGGAGAAATGAGTGACAGTGAAGGAAAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa1240
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110378 Nonsense 91 113 2 2
Genomic Location (Zv9):
Chromosome 2 (position 36214749)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 36511459
GRCz11 2 36493916
KASP Assay ID:
554-1155.1 (used for ordering genotyping assays)
KASP Sequence:
GGCTGATTTTACAAAGAGATTTTCTGCAACACTGGACTCCAAAGAAAAAT[C/A]ATTTCCACTGACAATCAAGAATCTGCAAGTATCAGACTCTGCTGTGTATT
Associated Phenotype:
Not determined