Busch Lab

ZMP

si:ch73-96b22.2

Ensembl ID:
ENSDARG00000078404
ZFIN ID:
ZDB-GENE-100922-193
Human Orthologue:
CDH26
Human Description:
cadherin 26 [Source:HGNC Symbol;Acc:15902]
Mouse Orthologue:
Cdh26
Mouse Description:
cadherin-like 26 Gene [Source:MGI Symbol;Acc:MGI:2685856]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa43902 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa43902
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110588 Nonsense 488 835 11 19
ENSDART00000138290 Nonsense 488 836 11 19
Genomic Location (Zv9):
Chromosome 23 (position 1004955)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 986209
GRCz11 23 995329
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACATGTACCGTGGTGGTGTATTTGGGTGACTTGAATGATAACGCCCCCTA[T/A]CTGCCCTCCAATAAAACGGTCATGTGTGCGAACAATATGAACCGTGTCCG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29850
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110588 Nonsense 603 835 12 19
ENSDART00000138290 Nonsense 603 836 12 19
Genomic Location (Zv9):
Chromosome 23 (position 1002719)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 983973
GRCz11 23 993093
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGTGTCGCGGTCTTCTTCCTCTGTCTTCCAGACTCGGTCCTGCAGCCATC[G/T]GACTCATGATTGCAGGACTCCTGCTGCTGGCCCGTGAGTTTCAGACTAAC
Associated Phenotype:
Not determined