Busch Lab

ZMP

si:dkey-92i15.4

Ensembl ID:
ENSDARG00000078387
ZFIN ID:
ZDB-GENE-030131-8422
Human Orthologue:
IL16
Human Description:
interleukin 16 (lymphocyte chemoattractant factor) [Source:HGNC Symbol;Acc:5980]
Mouse Orthologue:
Il16
Mouse Description:
interleukin 16 Gene [Source:MGI Symbol;Acc:MGI:1270855]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa6426 Nonsense Mutation detected in F1 DNA Not yet available
sa11030 Nonsense Available for shipment Available now
sa19139 Nonsense Mutation detected in F1 DNA Not yet available
sa22824 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa6426
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115086 Nonsense 87 1161 1 6
ENSDART00000142181 None None 328 None 6
Genomic Location (Zv9):
Chromosome 16 (position 24485667)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 22389983
GRCz11 16 22305373
KASP Assay ID:
554-5186.1 (used for ordering genotyping assays)
KASP Sequence:
CTTTTGAGAGGGGAAATGTTGAAGACTCAAGTCAGAAAAGTCATCCAAGT[A/T]AGGACCTCAACAAAGCTTGTACATCTGCTAGTTATWCCCACACTAACATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11030
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115086 Nonsense 881 1161 1 6
ENSDART00000142181 Nonsense 48 328 1 6
ENSDART00000115086 Nonsense 881 1161 1 6
ENSDART00000142181 Nonsense 48 328 1 6
Genomic Location (Zv9):
Chromosome 16 (position 24483284)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 22387600
GRCz11 16 22302990
KASP Assay ID:
2260-9596.1 (used for ordering genotyping assays)
KASP Sequence:
AGATTATGATGAGGAAAYAGACACWGAAGAGGACTCTGATTCAGGAGART[C/A]ATCTGTGACCATCACAAGCAACATGAGCCAAWCTGAAAGAAGAAGTTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19139
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115086 Nonsense 881 1161 1 6
ENSDART00000142181 Nonsense 48 328 1 6
ENSDART00000115086 Nonsense 881 1161 1 6
ENSDART00000142181 Nonsense 48 328 1 6
Genomic Location (Zv9):
Chromosome 16 (position 24483284)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 22387600
GRCz11 16 22302990
KASP Assay ID:
2260-9596.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGATTATGATGAGGAAACAGACACTGAAGAGGACTCTGATTCAGGAGAAT[C/A]ATCTGTGACCATCACAAGCAACATGAGCCAATCTGAAAGAAGAAGTTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22824
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115086 Nonsense 912 1161 2 6
ENSDART00000142181 Nonsense 79 328 2 6
Genomic Location (Zv9):
Chromosome 16 (position 24481555)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 22385871
GRCz11 16 22301261
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATACCCATTGCAGTCTCATGGACCTATGTAACTTTGGAGGGGTGGACTA[T/G]AATTCGCCAGAGTGGTTAGAAGATCACGAAGATTTGCCTTCCTCACGCTC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4655
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115086 Nonsense 968 1161 3 6
ENSDART00000142181 Nonsense 135 328 3 6
Genomic Location (Zv9):
Chromosome 16 (position 24481188)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 22385504
GRCz11 16 22300894
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGTTTTGCAATCGTAACTTGTATCTCTGGCTCTGACTTACAACAGAAATA[T/A]GAAGATGTGCAAGTRGTTGTGTTACACAAGGAGGTGGGGAGTGGCTTGGG
Associated Phenotype:
Not determined