Busch Lab

ZMP

trip11

Ensembl ID:
ENSDARG00000078381
ZFIN ID:
ZDB-GENE-030131-9833
Description:
Novel protein similar to H.sapiens TRIP11, thyroid hormone receptor interactor 11 (TRIP11) [Source:U
Human Orthologue:
TRIP11
Human Description:
thyroid hormone receptor interactor 11 [Source:HGNC Symbol;Acc:12305]
Mouse Orthologue:
Trip11
Mouse Description:
thyroid hormone receptor interactor 11 Gene [Source:MGI Symbol;Acc:MGI:1924393]

Alleles

There are 9 alleles of this gene:

Allele Name Consequence Status Availability
sa35539 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa35538 Nonsense Mutation detected in F1 DNA Not yet available
sa35537 Nonsense Available for shipment Available now
sa35536 Nonsense Mutation detected in F1 DNA Not yet available
sa7228 Nonsense Mutation detected in F1 DNA Not yet available
sa35535 Nonsense Mutation detected in F1 DNA Not yet available
sa35534 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28155
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109667 Nonsense 228 1984 5 22
ENSDART00000134383 None None 711 None 12
ENSDART00000137576 None None 245 None 5
ENSDART00000146138 None None 192 None 4
Genomic Location (Zv9):
Chromosome 13 (position 33423168)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 33069116
GRCz11 13 33199566
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGTGTCCAAGCTGCCAGGAGCTGATGGAAACGGAGACCAGGGTGAAGTTT[T/A]GAAAATGCAAAGAATTATCAAGGTAAAAAGCCTCTGAAATGTTACAAAGA
Long Flanking Sequence:
TCTGCTGTCCATCAAGGCTTTCATAGTGACGAGGTGGATCTCAGTGATGTCCTGTGGTCACAGCAGGAAATTAACCGTCTTTCCAATGAAGTGCATCGTTTAGAGGCAGATGTTTCTCATTGGAGGAGGGTTGCTCAGGTCACTTTACATGTATACCTTCAAAACAGTTTTTGAAATATGTATTGTGTGGTAACACTTTAGTTTAAGCACCAATTCTCACCATATTGGTTGTTTAATTGTACTAATAAAGTAAGTATTCTGCATGATCTTAATCTACATTCTAATCCTACCCAATACTTAAACCCATCTAATATTTTAATAACTATTAACAAGCAGCAAGTTAGGAGTTTTTTAAGCAAAACTGGTAGTTTATGGTTTGTAACTTAAAATAAAGTGTAGGCAATGGTGTTTCCGTTGAACTAGTATGAGACTTTTTATTTTAATTAATCAGGTGTCCAAGCTGCCAGGAGCTGATGGAAACGGAGACCAGGGTGAAGTTT[T/A]GAAAATGCAAAGAATTATCAAGGTAAAAAGCCTCTGAAATGTTACAAAGAGTAGTAGCTGTATATTTATTTAATTTTATATTGATTTCAGTAATGATAGTAATAATTAATATTAAAATATTTAGATCAGTTGCATAAAAGTTATGTTGCAATTTGTAAAGTAATATTTGTTCTATATTTAATGGATGTATTATATGAGACACTTACTGTAGCTTTGTTTACCAAACAAGTGGTTCTAATTGGATTTGATTTTAAACCTTAAATAAATTGTTAGGTTTTCAGCTCCAATACCATGGGTCACCAATCTCAATCCTGGAGGGTCGTTGTCCCTGCAGAGTTTAGCTCCAACTTGACTGGAATTTTCAAGTATACCTAGAAAGACCTTAGGTGCGTTCCATATTGCATATTTATGCACTATTCTATGCCATTTTGTAACATAAATAGTGTAAGTAGTGCATTCACACTTTAAATATTTGGATGATGCACTTATTCAACCAGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35539
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109667 Essential Splice Site 235 1984 5 22
ENSDART00000134383 None None 711 None 12
ENSDART00000137576 None None 245 None 5
ENSDART00000146138 None None 192 None 4
Genomic Location (Zv9):
Chromosome 13 (position 33423144)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 33069092
GRCz11 13 33199542
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGAAACGGAGACCAGGGTGAAGTTTTGAAAATGCAAAGAATTATCAAGG[T/G]AAAAAGCCTCTGAAATGTTACAAAGAGTAGTAGCTGTATATTTATTTAAT
Long Flanking Sequence:
AGTGACGAGGTGGATCTCAGTGATGTCCTGTGGTCACAGCAGGAAATTAACCGTCTTTCCAATGAAGTGCATCGTTTAGAGGCAGATGTTTCTCATTGGAGGAGGGTTGCTCAGGTCACTTTACATGTATACCTTCAAAACAGTTTTTGAAATATGTATTGTGTGGTAACACTTTAGTTTAAGCACCAATTCTCACCATATTGGTTGTTTAATTGTACTAATAAAGTAAGTATTCTGCATGATCTTAATCTACATTCTAATCCTACCCAATACTTAAACCCATCTAATATTTTAATAACTATTAACAAGCAGCAAGTTAGGAGTTTTTTAAGCAAAACTGGTAGTTTATGGTTTGTAACTTAAAATAAAGTGTAGGCAATGGTGTTTCCGTTGAACTAGTATGAGACTTTTTATTTTAATTAATCAGGTGTCCAAGCTGCCAGGAGCTGATGGAAACGGAGACCAGGGTGAAGTTTTGAAAATGCAAAGAATTATCAAGG[T/G]AAAAAGCCTCTGAAATGTTACAAAGAGTAGTAGCTGTATATTTATTTAATTTTATATTGATTTCAGTAATGATAGTAATAATTAATATTAAAATATTTAGATCAGTTGCATAAAAGTTATGTTGCAATTTGTAAAGTAATATTTGTTCTATATTTAATGGATGTATTATATGAGACACTTACTGTAGCTTTGTTTACCAAACAAGTGGTTCTAATTGGATTTGATTTTAAACCTTAAATAAATTGTTAGGTTTTCAGCTCCAATACCATGGGTCACCAATCTCAATCCTGGAGGGTCGTTGTCCCTGCAGAGTTTAGCTCCAACTTGACTGGAATTTTCAAGTATACCTAGAAAGACCTTAGGTGCGTTCCATATTGCATATTTATGCACTATTCTATGCCATTTTGTAACATAAATAGTGTAAGTAGTGCATTCACACTTTAAATATTTGGATGATGCACTTATTCAACCAGTAAAGAGTGGAATGACGAACACTTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35538
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109667 Nonsense 346 1984 7 22
ENSDART00000134383 None None 711 None 12
ENSDART00000137576 Nonsense 35 245 1 5
ENSDART00000146138 None None 192 None 4
Genomic Location (Zv9):
Chromosome 13 (position 33421651)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 33067599
GRCz11 13 33198049
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGAGAGCTATTGGCCACCTTAGAGGAGGCGGAGCATCATAAGACCAAGT[T/A]AGAGAGGGAGAAAGAGGAGGCAACAGCAGAAAATGCAGAACTGTTGCAGA
Long Flanking Sequence:
CTGCCCCATCTTGTTGATTAGTGCTTGGAATCAGTTTTTGTTTTTAACGTTGATTTTCTTACCCTATCAGGAGCTGAGAGACAAAATGGCACGGGAGGTGGATGAGCACCAGCACGAACTGGCAGCATTGCAGGATGCCCAGAGGCAGAAAATGTCTGACATCTCCAAAAGGCACAGACAGGAGCTGGCAGAGTATGAGGAGAGAATTGAAGAGCTTGAGGAGCAGCTTCAAAGTGGTGATTAATAGCATTTATGCATAATAAATTTAGAGAAATTAGCTTTCCATTTGATTTGATTTGTTTGAGTGTAACACTGTTTTTCTGACTTTTCTTCAGAAGGTGGTAATGCTGTCCAAAAATCATCCACAATGCAGGACTCCATTAAACTTCAGGAGCTGGAATCGACTATACGTTCTTTACAGGAGGAGGCGGAGCTTCAGCGCAAACAGCACAGAGAGCTATTGGCCACCTTAGAGGAGGCGGAGCATCATAAGACCAAGT[T/A]AGAGAGGGAGAAAGAGGAGGCAACAGCAGAAAATGCAGAACTGTTGCAGAATTACAGTCGGCTTCAGAAATCTGTGAATGAACTTCAGGCTCGGGTTCAGGAACAGGAGGGGAAGTCAATGTTGAAAGCCCAGCATGATAATGAAATACAAGTCCTAAAAAAAGCCCTTGCAGGTATAGTGATCTCAAGAAATGTTATATAATCATTAGAACTCCATGTTTGATATATCACATTATGTGGTACATTCATAAACTAATGTCTGATTTTAACTTTTTATAATTTTGTATTATATTTATAAGGTGCGGAGAAAGAGGTTGCTAGACTGAAGAGTTTCAGTGAGGTAAATTTACAACAAAAAAAGAGCACAAATCAGCACAGTTTAGACTTAAACATGCTTGCGATTTTAAATATAAAGCTTTCATGTAAATATGCTAAATTCAGCAACTCAATTTTTAATCTGCAATGTTCACCTCATCAAATAGATCTGACCCTACTCTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35537
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109667 Nonsense 538 1984 11 22
ENSDART00000134383 None None 711 None 12
ENSDART00000137576 Nonsense 227 245 5 5
ENSDART00000146138 None None 192 None 4
Genomic Location (Zv9):
Chromosome 13 (position 33420459)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 33066407
GRCz11 13 33196857
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTATTGCAGTGAAGGACCAGCTGTCCCTGCAAAAAACCCAGACTGAGGCC[G/T]AAAAAGCTCGTCTTCAGTCAGACCTCAATTCCTTACTTGACCAGAGACAG
Long Flanking Sequence:
TTTTAATATTCAACAACATGTATTTTTTAATTTGTTTTAAAAAATGCTTGTGTCAAATCAGTAGTTAATTGTTATCTTGAAAAGGGTGTAAATGTGCTTAACTGGTATACCTATCATACTGTTTGTTAAATTTTTTTCCTTAGCTTGTGTTACTTGATAGAATAGCCCTGGTTGAGGAGAGACACCGGTCTGGAGAGCCAGAGAGTGTTGGAGAGCTGTCACTGGAAGTTTCAGACCTAAAGAGCCAGCTTGACCAACGAGAGGAAGCTCTAAAGCAAGCACATCTTGATATAGAGACACTTACTGCTGAACTGGAAGAACTGGACAAACAGAACCAGGAGGCCACACAGGTACACATTTTAAGCCATGTTTACATGTTTATTAGTAATTGAATCTGTTGGATTGAAATTAGTATACTGTATGTTTACTTTGTTTTCTTTTTGTAGCATGTTATTGCAGTGAAGGACCAGCTGTCCCTGCAAAAAACCCAGACTGAGGCC[G/T]AAAAAGCTCGTCTTCAGTCAGACCTCAATTCCTTACTTGACCAGAGACAGTCTCTTCAACTGGAACTGGAAGCCCATGTAGAGAAACTAAGTCAAAGTGCCTTCTCCCTAAATGAACTGCACATGGCAAAGCAGCAGCTCGAAGCTACAGTAAAGGAGTTGAGGGAAAAGTTGTGCAAGTCCCAGGATCTGGGCAAAGAGTTGCGGCAGGAGTCCTCTGAGCTCAAGAGAGCGCTTCAGCAGAGAGAGACAGAACTTACTGCACTTCATGAGGAGTTAAGCCATACAGGGGAGCAGAGGAATGAGTTAGAAGTGCACAGGAAAATACTTGAGGCACGGGATAAAGACATCCATGACTTAAAAGCAGAGTTGGCAGAAGTGAAGGTCTCTTACGAGAGGGCCGTTTCAGAAGACTTTGAATTGAAAATTGATAATAGAAAGTTGACAGAAGAAAGGACTCGGACTTTAGAAAAGACGGACAGCTTGGAAAGGCATATCCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35536
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109667 Nonsense 751 1984 11 22
ENSDART00000134383 None None 711 None 12
ENSDART00000137576 None None 245 None 5
ENSDART00000146138 None None 192 None 4
Genomic Location (Zv9):
Chromosome 13 (position 33419820)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 33065768
GRCz11 13 33196218
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCTAAGTCAGACTGAGAAGCGACTGTCAGATCAGGCTAAACAATATCAA[C/T]AAACTATTGATGAACTGACCAGAGCACGTTCCATGGATGCTTCTGCACTG
Long Flanking Sequence:
TCGAAGCTACAGTAAAGGAGTTGAGGGAAAAGTTGTGCAAGTCCCAGGATCTGGGCAAAGAGTTGCGGCAGGAGTCCTCTGAGCTCAAGAGAGCGCTTCAGCAGAGAGAGACAGAACTTACTGCACTTCATGAGGAGTTAAGCCATACAGGGGAGCAGAGGAATGAGTTAGAAGTGCACAGGAAAATACTTGAGGCACGGGATAAAGACATCCATGACTTAAAAGCAGAGTTGGCAGAAGTGAAGGTCTCTTACGAGAGGGCCGTTTCAGAAGACTTTGAATTGAAAATTGATAATAGAAAGTTGACAGAAGAAAGGACTCGGACTTTAGAAAAGACGGACAGCTTGGAAAGGCATATCCAAGAATGTCAAGCTTCTCTAAGCAGGATGTCTCTCGAGAAAGACACCCGTATTGAGGCCTTGAAATTAGAAAAGAGCCAGCTAGAATCTGAGCTAAGTCAGACTGAGAAGCGACTGTCAGATCAGGCTAAACAATATCAA[C/T]AAACTATTGATGAACTGACCAGAGCACGTTCCATGGATGCTTCTGCACTGCAGACCGAACATGAGCGAATGGTGAAACTCAATCAAGAAAAGGATCTCACAATTTCAGAGCTTAGGCGTGAAATAGAGCAGATGATCTCAGACCAAAAAGACACCAGCGAGATGTTGGACATAACAGTGGCTGGCCAAAATCAACTCACTGAGCTTCTCCAGGAGAAGGATGCTTTTGCAGAAACCCTAAAAACTCAAGCTGTGGAAACACAACAAGAGTTGGAGACCCGTATCTTGAGAGCAAGTCAAGAGTGTGACTCTCTCAGAAAGTCAGTGGAAGAGAAAGACAAACAGCTTGGAGCCATGAAGGAAGAAAACAGCCATTTGAAAGAAGAGATTGACCGTCTGAGGGACCAGCAGAGCAGACCACAGTTAATGTCAGAGCCACGGACACTGGATATCATCACAGAGCTTGAGAATGAGGTCGCCCAGCTCAAAGCTGCCAGAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7228
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109667 Nonsense 846 1984 11 22
ENSDART00000134383 None None 711 None 12
ENSDART00000137576 None None 245 None 5
ENSDART00000146138 None None 192 None 4
Genomic Location (Zv9):
Chromosome 13 (position 33419534)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 33065482
GRCz11 13 33195932
KASP Assay ID:
554-5276.1 (used for ordering genotyping assays)
KASP Sequence:
CCTRAAAACTCAAGCTGTRGAAACACAACAAGMGTTGGAGACCYGTATCT[T/A]GAGAGCAAGTCAAGAGTGTGACTCTCTCAGAAAGTCAGTGGAAGAGAAAG
Long Flanking Sequence:
AATTGATAATAGAAAGTTGACAGAAGAAAGGACTCGGACTTTAGAAAAGACGGACAGCTTGGAAAGGCATATCCAAGAATGTCAAGCTTCTCTAAGCAGGATGTCTCTCGAGAAAGACACCCGTATTGAGGCCTTGAAATTAGAAAAGAGCCAGCTAGAATCTGAGCTAAGTCAGACTGAGAAGCGACTGTCAGATCAGGCTAAACAATATCAACAAACTATTGATGAACTGACCAGAGCACGTTCCATGGATGCTTCTGCACTGCAGACCGAACATGAGCGAATGGTGAAACTCAATCAAGAAAAGGATCTCACAATTTCAGAGCTTAGGCGTGAAATAGAGCAGATGATCTCAGACCAAAAAGACACCAGCGAGATGTTGGACATAACAGTGGCTGGCCAAAATCAACTCACTGAGCTTCTCCAGGAGAAGGATGCTTTTGCAGAAACCCTAAAAACTCAAGCTGTGGAAACACAACAAGAGTTGGAGACCCGTATCT[T/A]GAGAGCAAGTCAAGAGTGTGACTCTCTCAGAAAGTCAGTGGAAGAGAAAGACAAACAGCTTGGAGCCATGAAGGAAGAAAACAGCCATTTGAAAGAAGAGATTGACCGTCTGAGGGACCAGCAGAGCAGACCACAGTTAATGTCAGAGCCACGGACACTGGATATCATCACAGAGCTTGAGAATGAGGTCGCCCAGCTCAAAGCTGCCAGAGATCAACTCAAAGAAGAGGTCCAAGCTCTGAGGAGACTTTCTGAAGAACAACAGACAACAGCCCTGCAGTCTCAACGCTCCCTTCAAAGTGAACTAGAGCAAGCACGGTCAAGAAACGAGCAAAGCGCACTCAATTACGAAAGACTCATCAGTGCTAAAGATGAAGAGATTGCCCGGCTTCAGTCAGAAGTAGAGGGCCTAAGCACACAAGGACGAAGTCAAATACAGTCCGTGGAAATTCTACAGGAAGATAAGACCCAGTCTCTGAATGGTGAAAACGGTAATGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35535
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109667 Nonsense 988 1984 11 22
ENSDART00000134383 None None 711 None 12
ENSDART00000137576 None None 245 None 5
ENSDART00000146138 None None 192 None 4
Genomic Location (Zv9):
Chromosome 13 (position 33419109)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 33065057
GRCz11 13 33195507
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGAGATTGCCCGGCTTCAGTCAGAAGTAGAGGGCCTAAGCACACAAGGA[C/T]GAAGTCAAATACAGTCCGTGGAAATTCTACAGGAAGATAAGACCCAGTCT
Long Flanking Sequence:
AGGAGAAGGATGCTTTTGCAGAAACCCTAAAAACTCAAGCTGTGGAAACACAACAAGAGTTGGAGACCCGTATCTTGAGAGCAAGTCAAGAGTGTGACTCTCTCAGAAAGTCAGTGGAAGAGAAAGACAAACAGCTTGGAGCCATGAAGGAAGAAAACAGCCATTTGAAAGAAGAGATTGACCGTCTGAGGGACCAGCAGAGCAGACCACAGTTAATGTCAGAGCCACGGACACTGGATATCATCACAGAGCTTGAGAATGAGGTCGCCCAGCTCAAAGCTGCCAGAGATCAACTCAAAGAAGAGGTCCAAGCTCTGAGGAGACTTTCTGAAGAACAACAGACAACAGCCCTGCAGTCTCAACGCTCCCTTCAAAGTGAACTAGAGCAAGCACGGTCAAGAAACGAGCAAAGCGCACTCAATTACGAAAGACTCATCAGTGCTAAAGATGAAGAGATTGCCCGGCTTCAGTCAGAAGTAGAGGGCCTAAGCACACAAGGA[C/T]GAAGTCAAATACAGTCCGTGGAAATTCTACAGGAAGATAAGACCCAGTCTCTGAATGGTGAAAACGGTAATGAGAAACATGACCTGTCAAAGGTGGAAATTGAGAAACTTGTGAAAGGCATCAAGGAGAAGGAGACTGAAATTAACCAGCTCAATGAAAAGAACCTCTGTCTAACCAAGCAGCTGGACCAACTTGTAGTATCTCAAAATGAGCTGGGAAAACTCTCACAGATGGTGCGCCAGAAGGATCTAGAAATCCAAGCGCTTCATGCTCGAGTGTCTGGAGGCCATGGTCAAGATGTGGTGTTCCTTCAGCAGCAGCTGCAGGCGTATGCGGTGGAACGGGAACAGGTGCTGGCTGTACTCAATGAGAAGACCAGAGAGAACAGTCAGCTGCGCTCAGACTACCATCGCATTATGGACATAGTTGCTGCCAAGGAGGCAGCCCTGTTAAAGCTTCAGCAAGAAAACCAGCGGCTCTCCACCATGAGCGACCCTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35534
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109667 Nonsense 1293 1984 11 22
ENSDART00000134383 Nonsense 20 711 1 12
ENSDART00000137576 None None 245 None 5
ENSDART00000146138 None None 192 None 4
Genomic Location (Zv9):
Chromosome 13 (position 33418193)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 33064141
GRCz11 13 33194591
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCCAGGCTTATTCAGAGCTATGAGCAGAAAGAGAAAAAGCTTGGATTGT[T/A]GAGTCAAGAGCTGGCACAGGTGCAGCAGACCATCAGCCAGCTGACCAGTA
Long Flanking Sequence:
TATGGACATAGTTGCTGCCAAGGAGGCAGCCCTGTTAAAGCTTCAGCAAGAAAACCAGCGGCTCTCCACCATGAGCGACCCTTCAGGGAGTCAAGAGATGTTTCGAGAGACCATTCAGAACCTCTCCCGCATTATCCGTGAGAAAGACATCGAGATCGATGCCTTGACACAGAAATGCCAGACCCTGGTTTCTGTCCTCCAAACATCTGGCTGCAGTGATCCTGTGAGTGGTGGCTCTGGAGGTGTTAGCAGCAACCAGTTTGAGGAGCTCCTACAGGAACGTGACACTCTCAAACAGCAAGTTAAAAAGATGGAGGAGTGGAAGCAGCAGGTGATCACGACCGTGAGGAACATGCAGCATGAATCTGCACAGCTGCATGAGGAGCTGCTCAAGCTGCAGGGGCAGGTTTCTGCCGACAGTGACTCAAGCTCGAAGCTATCTGTGGATTATGCCAGGCTTATTCAGAGCTATGAGCAGAAAGAGAAAAAGCTTGGATTGT[T/A]GAGTCAAGAGCTGGCACAGGTGCAGCAGACCATCAGCCAGCTGACCAGTACCAAAGACGTTCTCCTCGGGAAGCTTGGCAGTGTCAAGCAATCTCCAGAATTGTCTGCCATGGTTCCTAGCCAGGCTCTTGCCCCTTCAAACCTGAGGGGGGCAGCACCTTCAGCCCAAGATGACCATATACATCAGGATATGCAGGCATTGCAGAGAACTTTAGCAGAGAAAGAGAGCATGATAAGAACTTTGCAGGAAAACAATCATCGCTTGTCAAATTCTGCATCTCTGTCTGAAAGTGAGCAGAGAAGCCATGCAGAGGAGCTCAAGCAAGCTAGAGAGAAGCAAGAATCTTTGCAGCGTTCCCTCAGAGAGAAAGATCTACTCATTAAGACTAAAGGGGACCAGCTCGGGCAGGTAATGTAGAAGGACAATACACAACAATACCTAAGCTGCATTGTGTCAAAATGCTAGTTTTCATCCCTAGTCCCCGGACAGGTTGGTGTTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7729
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109667 Essential Splice Site 1725 1984 17 22
ENSDART00000134383 Essential Splice Site 452 711 7 12
ENSDART00000137576 None None 245 None 5
ENSDART00000146138 None None 192 None 4
Genomic Location (Zv9):
Chromosome 13 (position 33410868)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 33056816
GRCz11 13 33187266
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTGTGGATATAYACAGTACATTAATGCTCAATATCTACATCTGTAAACTT[A/T]GATAAACCTGGATGAAGCGAACGCAGCTCTAGAATCTGCCTCTCGCCTCA
Long Flanking Sequence:
GCTGAACGGTGCTGTCAGACAGAGAGATGAAGCTCTTATTCAGCTCCGAGCTTCTCAAGATCAGGTCAACCAGTATGCAGTGTCACTCTCTAACCTGCAGATGGTGCTAGAGCAGTTCCAACAAGGCAAGACCTGTGTTTTGCTGTTCAGTTTAGTGTATTTTATATAAACAAAATATTTTGTACAGAATAATGAACATTAAAGATATTACAAATTCTGATTATAAGATTTTTTAATTAAAATGGAAATCTGCAATAAATCTTGAGTAAAACTGACATGTGTATATGTCTTTACAGAAGAAAAAGCCATGTACTCAGCAGAACTGGAAAAACACAAGAGAGAGAAAATGGAGTGGAGAAATAAAGCAGAAAGTCTTGAAGAAATTGCGGCTGCTCTTCGAGTCAGTTTAAACAGTCATGTACACTAAGCTCTACTTTCTGAACTGTGTTTGTGTGGATATACACAGTACATTAATGCTCAATATCTACATCTGTAAACTT[A/T]GATAAACCTGGATGAAGCGAACGCAGCTCTAGAATCTGCCTCTCGCCTCACTGACCAGCTGGACCTCAAAGATGAGCAGATAGAAGACCTGAACAAACAAGGTGAGGCAGAATGCTGAAATCAGCTCTACATTTTGATTCCTGTTGAGCTAGGACAGCAGTTCTCCACCATGTAAAGGCGCCTTGTTGTCTAGCACATTATTCAAAACCCCCACATATTGGCAAAGATAATTCCGTTGGTATTTCTGCTGTAATTATGACACCAGTGTTGTTTTCCAAATTGAACTTTACCGTGTGTATTTCAGGGCATTAAATGACATTAATTCTCTTGTCTATTTCGTGAACACAAACAGTAAGTTTGTCTGACAGGCAGTTCACTTAAAGGGCACCTAGGTTACTCCTTTTTTCAGAATAATATTTAAAATAAGTCTTTTATGTCTCCAGAATTTGTCTGTAAAGTTTCAGCTCAAAACACCCATCAGATTTTTTATTATACCTTTT
Associated Phenotype:
Not determined