Busch Lab

ZMP

ENSDARG00000078362

Ensembl ID:
ENSDARG00000078362
Human Orthologue:
FN1
Human Description:
fibronectin 1 [Source:HGNC Symbol;Acc:3778]
Mouse Orthologue:
Fn1
Mouse Description:
fibronectin 1 Gene [Source:MGI Symbol;Acc:MGI:95566]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa45186 Nonsense Mutation detected in F1 DNA Not yet available
sa12021 Nonsense Available for shipment Available now
sa33527 Nonsense Mutation detected in F1 DNA Not yet available
sa20338 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa45186
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112856 Nonsense 425 1585 2 14
Genomic Location (Zv9):
Chromosome 5 (position 5762732)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 5306714
GRCz11 5 5798627
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCTAATAATTGCAATAATCGCGGACGTTGCGTTAACGGTCAATGTGTTTG[C/A]GATGAGGGATTTGGGAGCGAGGATTGCGGTCTTAAAACCTGTCCATCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12021
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112856 Nonsense 532 1585 2 14
Genomic Location (Zv9):
Chromosome 5 (position 5762411)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 5306393
GRCz11 5 5798306
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGTGTCTGTCAGGATGGTTTTAAAGGCCAGGATTGCTCTGTTCCCACTTG[T/A]CCTGGAAACTGCAATGACCACGGGCGCTGCGTCAATGGAAAGTGTGTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33527
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112856 Nonsense 572 1585 2 14
Genomic Location (Zv9):
Chromosome 5 (position 5762293)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 5306275
GRCz11 5 5798188
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGATGCCTGCAGTGACAGAAGCTGTCTGAATGACTGCAGTGATGTGGGA[C/T]AGTGCGTCGACGGCCGCTGCATTTGTGATGAGGGATACATTGGCGAGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20338
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112856 Nonsense 926 1585 8 14
Genomic Location (Zv9):
Chromosome 5 (position 5743573)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 5287545
GRCz11 5 5779887
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTTCATCTGCTGGACTAACACATTTTTGTGTGCTGTAGGCTTAAAGCCT[G/T]GAACGGAGTATGGGATTGGAGTCACAGCCGTGCAGAATGAAAGAGAAAGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8365
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112856 Nonsense 1160 1585 10 14
Genomic Location (Zv9):
Chromosome 5 (position 5733917)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 5279661
GRCz11 5 5772003
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TAAAATCTTCCACTGAGTWCCAAGTAAGGCTTTATGGATTATCCAATAAC[C/T]AAAGGTCTTCGCTACTAGAAGCAGTTGCAGTTACAGGTATCAGCTTTCTT
Associated Phenotype:
Not determined